Description :
From Genome Similarity Track
Location :
contig_8:617199- 618718
Transcript NameFunction/comments
g1661.t1hypothetical protein

Sequence
1519 bases(100 bases per row)
TCCTTGTCAGACTCCACCACCACGCACTTGACCACGACGTTCGAGTTCAGCCACCATCCGCGATAGACCTTGCCAAACGAACCAAACTGAATGGGTCTTT
CTCTTTCCGGATCTCACGACTAGGAAGGAACCACTCTGGTTTCTTACGAGCGACGGGAGCGCTCAAAAATGCCACACCGGTGTTCGAGGAATCGCCACTT
CCTTTATCAACGGGGTGCTCGAGGAGATAATCCACAATCACACGTTCAGCATCGATGCGGTTGTTCATCCGAGCGTAGTCGGAGGCGGTACGGTTTGCGT
TGTCTGCCTTAGCGGTATTCGCGTTATTTTCAAGAAGCACACGCAAGATGTGCTCGTGGCCTCGGTACGCAGCTTTCATTAGTGCGGTCTGGCCGCTCTC
GTCGGTTGCTTCAATAGCCGCACCGTGGTTTAGTAAAGTTTCAACCACTGCGTGGTGCCCGTCCTCTGCAGCAAGCAACAACGCGTCCGTCCGCTATTCT
CTGTCGCATCCACATTGGCATTGCTCTCGACGAGCAGCTTTACAAACTCCTCATTCCCTGCTTGCGCTGATGCCATCAAAGGCGTGAATTCAGCATTATT
TGGCAAATTCGGGTCGGCTCCATATTTCAAGAGAGCTCGCGCACAGTCCAGCTGCTTCTCGTAGATGCACTCGTGCAGAGCTGTGTCTCCATCATTGTCT
TGGGCATCAACACTCGCCTGGTTAGTGAGCAGCAGTTCGATCATGTCAACATGACCAGAATCTACAGCTACCAGCAGTGGAGGGCAATTGTTGCTATCTC
CAAGACTGACATCGGCTCCATGCTCCAGCAGCAAACGGATGACTTCCACGTGGCCATTCAAGGCGGCGATTGTCGTGGCTCTCTCTCCTTTCACGGCCTG
AACATTCACTGTAGCTCCGTGCTGAAGCAAAAGCTCGACGATCGTCGCGTAGCCCTCTTGTGCTGCACACATCAAAGGCGTATACCCATCCGTGTGCGCT
AGATCAATTGCAGCACCACCCTCGACAACAGCACGAGTTGCTTCGAAGCGACCAAGAAACGCCGCCTGGATTAAAGCAGTGTCTCCATTCGCAGTTCGAT
AGTCGACCGCAGCCATGCTCTCAACCAGGAATTTTACGACATGGTGTGGCCTCTTTCAGCAGCAAGAATCAGCGGTGTGGTTCCTTCGGTATTGGCCACA
TCAACCCCAGCTCACTATCAATGAGAAGGCGAACAATATCCAGATAGCCTTCTTTTGTCGCACAGATCAAAGGCGTGAACCCTTCACCATCAGCTAGCTC
CGCATCTGCCCCACTTTCAATCAATACCCTGGCGATTTCCAAGTGTCCTTTGTTAGCTGCTCGAGTGAGTGCCGTGTCCCCATTACCCGCCTGAGCATTG
ACCACAACATTCTTCTGGATCAACATCCGAACAGCGTCCAATTGTCCACACGAGGCTGCTCGAATGAGCGGCGTGTCCCCATTTCCACCCTTCAACTCAA
TATCGGCCGCACCATCTAC