Description :
From Genome Similarity Track
Location :
Scaffold_217:61713- 62716
Transcript NameFunction/comments
g3061.t1hypothetical protein

Sequence
1003 bases(100 bases per row)
GACTTCCCACTATGCCGGCGGGCATAAATGGGCGCCTCAGCACCGCGGCTCCGAAGAGCAGGTTGGATGGCGGACTGTCTTGGAACGCATTTCGGGCGCC
AGCTGCAATCTTTTTATCGGACCTCTAACCTGGAATTATGCTTCCCGGGGGTGAAGGGAGCCCCCCAAAATAGCATGTTCACCAGAAAGCCCGAAAATAC
GGGGTAACCGTCACGATTGCTTCGAGAGAGGTCGGCCTGGCTCGCTGGGCAGGGATGGGATCCTCTTGGGGGCTGGCTAGGCCGCATCAGTGTGGCCGTC
ATAGGGTACCCATCCCTCCATGCAGTTGTGCCCTTCCCACACAATGCACGGCTCCGGTTATCCTCCTCTAACACGCACGGTTACCCCTCGACTGCCCTGA
AGGTACCAGTTATCCGCAACAGGCGGCACTCCCGAAATCGTTATGTATTAGAATTAAATAGGATTAATCTATACCTACCCTGCCTGCGGCGGGGATGACC
TGCCTGCGAAGCTATCCCGCCCGGTCCTCCGTCGAGCTGGTCCGTCGCCGGAGCGTCGTTTTGAAAATGGAAATGAAAAGAAAAGTTGTTGAAAGGCGGT
TTATTTTGTCCAATCAGCAGTGATTTCATTCGGCTAGTTCCGATGTGGTGTAGTCCACTCTACGCATTATAATAGCCAATCGCGCAGAAGTTCCACTAAA
TAGCCAATAAGAGGCCTCGCATTATAATAATAGCGAATGGGGAGGCCGCCTTCGCTGCGCTCGGCAGCTATTTATAGCCAACGGAAAGTCCGGATTTGCG
TTACGCTCGAGGTGCGTACGGAATGACGGACAGACGGACAGGTTACTCTGTTACTTGTAGGAGACTAGCCGAGCGCCGCCCGCGTTGCGGGCGGTGGGTG
CATGGTTGGTTGGTGCCCGTTCGCTCGCTCATCCAGCTCGCTTCACTACTATTTTTACTATGACAGGGTTATGTTTTATCTCAGTATATTTTACAGTAGA
CTT