Description :
From Genome Similarity Track
Location :
Scaffold_90:61700- 63766
Transcript NameFunction/comments
Phypa_INRA-310PPTG_18675hypothetical protein

Sequence
2066 bases(100 bases per row)
TGTCGGCCCACGTTTGCTCGCTGCTACGGTGTGGTGCCGCTCACTGTTCAACGATACAAAAACCACGTCCGTGACGGAAATATCGGGGCGAAGAGTCATG
GGAACACTTTGAACCAGAACGCAGCGGCTGTCGATCTGGTCTGGTTAGTGAAGTGGTTTAAGGAGTTTGCAGAGGAGGTTGGGGAGGTTGTGCCGGTGAG
AGTTCGAATGCAGAAGACGAAGGATGGCGTCACGAAGAAATATTACAGCAGCGAGATGTACACGCTACTGCCCGCGCACTTCACATGGAATGTTTTGTAC
GAGGAGATGCACAGCTTCGTGGAGCAGATTCGCCTGCGCGTCCGAGAGCCTGCACCTTCGACGATGAGCAAGCTACTGACGCTCCATTGTCCGACCATTC
GCATTCGGTCGCCAAGAAGCAACGTGTGTGATATCTGTTCCATCTACCATACAAGCATGCGCAACGACGTCAGTGCAGAAAAAACCGAGGCGCTTGGCAG
ACACACGGAGTCCGCTCGCAAAATGCGGTAAGGGAGATTGGTATCAATTTAATCTACTGGTAGCTTTTAACAGGGGATGTTAATATCTTTTTGTTTTGGT
TGCAGCCGTGAATACAAGAAGGACAAGACTTCAGTGAGCGACGACCACGCCGTTATCGTCATGGACTTCTCGCAGAACCTTACTGTTCCTAGCATTGCCA
GTACGCCGTCGCAGTGGTATTTTTGCTCACTGTTGTCCGTCAGTTGCTTCGGCATTTTCTGCGAGAACGACGGTATTCAAACCAACTACCTCTACGATGA
AACAGCGAGTGGAAAAGGCAGCGACCAGATCAACTCCATGCTAGAACATTTTCTCCGGACCAAGGTTCTGTCTGAAGGCAAGAATAGATTGACTGTTTAC
GCTGACAATTGCTCGGGTCAGAACAAGAACAACTACGTCATCAAGTTCTTGTTGGCGCAAGTGGACATGGGGCTGCTGAAGCACGTAGACTACAAGTTCT
TTGTAAAGGGCCACACGAAGAACCCGTGCGATCGAGGTTTCAGTCATATTCGCAAGCATGTTGCGAAAGTAGATTGCTATACTGTGGCTCACGTAGTGGA
CGCTGTTAAGGAAGCCGCGGCGAACGCTGTGACGGTTCACATTCCACGTGGTAGCTCGCAGTTTAAGAGTTACAAGGGCGTGCTGAGGGAGCTGTACAAA
CGCCTAGAAGGCATTCAGCAATATCAGATCTTCTCCATGGACGAAGTGTCGATTGGAGTAGTGTCGTGTAGGAAGGAACCTAACGATGAGCCCGTCGAGA
TGAATCTCCAGCGTAAGTTTGACGGTATCCTCACGACAAAGGAGAAGGTGGTGAAGATGATGAGCGACCACGTGGAGGTGCTGGCCCCACCACCGCCCAA
TGTGGAGAAAAGACAAACGATGTACCATAACATCAGGCCATACGTCCCTGAGGAGTTCCGAGACGATTCACTGTACGCAGAACCGAGTGCGCAAGACCAC
CTGGATGCCAAAGCAGCCAAGCAGGCACGCCGAGACCACCGTGCGGCCATGGTAGTGGCAGCGAAAGCGAATCAGGACCGTCGTGGGCTCGAAGACGTCG
GGCCAAGCGCCGAGGAAGCGCCTGCAAAGAAGAGGAAGGCCCCAAAGAAGTAAGTGCTTCGGCAGAATATGCGATTTACCCGATAAATCGAATTGATATC
TACGTCCATCAGTGTATAGATTTCCGATTTTTCAAAAAAAAATTCAAAAACAACACTTGGGTACACTGGAGTGGCAACACAAAACTGGCAAAACTGACCT
TTTAGAATACGAATTAGCGTAAACCGAGGCCACCACTGGATTCCTTGGGCGATTTTGGATCTAATTCACCAATAAAAAAATATCGACTTCGACGTCCTTG
ACGGAGATAAATTTTTGGTCAGCCGATTTCTCCGAAACGGCTGAATGGATTTCTTCGTTTGACGGCTCTACGGACGGCGGAGATACAGGGCTTTTCAAAG
GTGTGCCTTAGACGCTTTTTAATTAATGGTTGATTAGTAACTTTTTGTTTGACGCAGTCTCATATG