Description :
From Genome Similarity Track
Location :
Scaffold_96:6169- 7370
Transcript NameFunction/comments
Pytir_DAOMBR486maker-pir_contig_96-snap-gene-0.26Cysteine protease family C01A

Sequence
1201 bases(100 bases per row)
CGTGTCAGGAGCTAAACTGGTGGTAAGGATTTGCACGTGAAAGTGAGTGGCAATCAGGAGTCATGCGAAACAGATTGATTGATTGCAACTTGGTGTGATG
AAATGGTAATGTGCACTATTTTATATTTCTCTTTGTTTATGTATTATATTCCCTAGCTTGATGGTGCCTGGAAGTCTAAATGCTGGCGACGACGACACTG
CCCTTGGTGACCTTGTTCGCAGTTCCCGACTTGAACCAGCACGTGCCAGCCTCGAACGCGTTCCAGGCGAACCCGGCGCAGCCCTTGACGGTGTGGCAGA
GCGCGCAGCACGCCTCTGGGGAGCGGGCCGGCGCGTTGCCGATGTCCTGACCTTCAAAGTCCGAGTTGAACTCGATCTGCTTGCACTTGTACACGATCGC
CGAGACGAACTCCTCCGAGTCCGTTGACGCGTGGTACGTGGCGGCAGGGACCTTGCGGGTCTTCAGCGCACAGGTGCCACCGTTCTTCTTCGACCAAGTG
AACGCGTGGCACTGCGCGACGTCGCTGCAGAATGCGTAGCAGTCGTCGGCTTTGCTGGCGGCCACTTCGCTCAGATCGTTACCCGGGTACTCGTAGCCGT
ACTCCTGCGGGGTGTTCTGGCGCGTGCACTTGGAGATGTCATGGAACGAGCCCGAGACCGCGTCTGCGCTCGGCACCACGAGCCCGGCGCGGCTCTTCTG
CCAGCACCACCCATTCTTCCACTTGGTGAACGTGAATGCGTTGCATCCCGCGGTGGCTTTGCACAAGGTGCTGCACTCGCTGACCGATGAAGCACTCGAG
TTGAAGATGTCGTTGCCCAAGAAGTCGACGCCTTCCTGGAACGATCCAGAGGCGGCAGCGTCACCACCAGCCATGGTAGTAGGAGCTGGTGTTGGCGCTT
CGCCCTGGTACGGATCTGGCAGAACTGGTGCGAGGAACGGGTTGGTTTCGACAGGGGTTGGGGCGGCAATGGCTGGGGCAGTAGTTTGAGCGTTCGTCGG
AGTCGGGGTTGGAAGTTCAACCTGGCTCTGGGTTGGAGCAGGAGTTGGGACGCTGGTAGAAACCTTGGTCGACGCTGGTGTGGCAGCCGGGACGGGAGCC
TTCGTTGGAGCCTGAATTGGGGCCTGAGTTGGAGCCACAGTCGTTGAAGCAGGGGTAGGAGCCTGAGTTGGGGCCACGGTTGGAGCAGTCGTCGGAGCAG
T