Description :
From Genome Similarity Track
Location :
contig_13:616864- 618457
Transcript NameFunction/comments
g2921.t1XP_009521393.1 hypothetical protein PHYSODRAFT_555600 [Phytophthora sojae

Sequence
1593 bases(100 bases per row)
TGGACGCGGATGGAGCTGTGCGTCATCGCCAGTCTGCAGCTCGTGCTGGTGCTCGTGGCCTACCGCTTGGACCGCTCGCAGCACCCCGTGCTCATCTCGG
AGTCCGCCGTTGCCATCCTCTTCGGCGTATTGGTGAGATGTACATGCGACAAAAGACAGATTAAAAGGTCCGGACTGACCATTGATGGGGTTTCTGTTGT
GTAGTTTGGAGTCGGTGTGCTGGTCTTCTACCCTATGGTATGTCGACGGCGATTCGAAGACTCTGTCCGGTGGGTCGTAGACTAATACGACTATTGCTGT
AGGAATCGCTGAACAACGGCATGGACCCCGAAGTGCTCTTCTACGCGTACGTTTCGCAGACTCAATCGGTGAATTTTGGGAAAGCGTCCAAACTGACAGA
TTTTGATATTCTGCAGACTGCTACCACCGATTATCCTGGAAGCTGGGTTCAACATGAAAAAGAGGGTATGCATGAAGTTAGATAGAGTTTGGTGGAACAG
ATTGGTAGCTCACCGCGATGTGCGACTTTTGTGTTATTTTGCTGTCTGATAAACGTCAGGGATTCTTCTCCAACTTCAATGCGATTATGCTGCTGGCTAT
CGTTGGAACGCTGGTTGCGACGTTCATTACGGGCGGTGTGCTGATTTGGCTGGGAGATATGGGGCTGATCACTAAATTGACGGCGGCGGAAGCGTACCTT
TATGGAGCTCTGATTTCGGCGGTGGATCCGGTGGCTACGTTATCAGTGTTCAAGAAGAATGGTGTGCCGCCTCTGCTATTTAACCTCGTGTTTGGTGAAA
GCATGCTGAACGACGGCGTTGGTAAGATATCACATTTAGGTCTTACTGGAGAACTTGCCTTGTGTTTACTAAATTGTTGCTGGTGTTGTGCTGCAGCCAT
CGTGTCTTTTACACTGTTCCAGGGCCTTATTCGAAATGGCATTACTGACGTCACGTTGAACGATGCGGGCATTATTATCATCAAGGTTTTTGGCATCGGC
TTTGGTTCGGTGGGTCTGGCTGCGGTTGTGTGCTTTACGTCGGCTTTTTTGCTCAAGCAAGCTGACCCAGTCCTTCAACAGTACCCCTCCTACGAGATTT
CTATCGTGCTGCTGTCGGCGTACTTGAGTTACGTGATTGCCGATCTCGTTGGAATGAGTGGTATCGTAGCGCTCTTCTTCTCGGGTGTCTTAATGAGCCA
CTACCACCTGTACAACATCGCAGATGAGAGCGCGACAGCGCTGAGGCATCTTTTGACCACGTCTTCTTTCATGGCGGAGAACTTCGTGTTCATTTACATG
GGTATGAGCGTGGTGGCGTACTCAGGATATTTCACGTGGGATTGGGGATTTATTCTCGCGAACATGGTCGCTTGTATTTTGGGGCGCATGCTGAACGTGT
TCCCAATGTGCATGCTTGCGAATCTCTGCCGAGCGGAAGACAGCAAGATCCCGTGGAGTCATATGGTGGTTGTCTGGTTTGCTGGGCTTCGTGGTGCGAT
CGCGTTCGCACTGGCACTCAACGTGTATACGCCCAACCGCATCCACGCAAGTGTGATTCAAAGCACGACACTTTTCACCGTCATGTTCACTAC