Description :
From Genome Similarity Track
Location :
scaffold_6:616546- 617804
Sequence
1258 bases(100 bases per row)
GAATCTGCTCTCTGGTCTTCCACCCGAACGCGAAGTTCAACACCAAATTGATCTTGAATCTGGCTCAAAGCCTGCAGTGCTTCGACAGTGGCCGCTATCG
CGTGAATAAAGTGAGTACAAAAACGAGCTTTCTGCTGAAAATCAAGCTGCTGGTTAGGaaaagcaagtctccccacaGCGCaccgacgttttgtgtgcgt
AAATCAAAAgtaaatggcgtatcgttctcgCCTATACCAAGTTGAATGCGCAGACGATTTACGCACACACTAAATTCCGAGTAAGGAAGTAATCATCCAC
CGTATGTCCGACTGTACACCGTCTAGTGTACTGCATTGCTCGATGGTTATCACCAAATCTCGATGAGGGAGATGGATGTCGGCTGTCAGTACACCGTTCG
GATGTTATGTGAGTGACTTGTGATGTAACAGGGACTATCCAATGCCTCAGCAATATTAAACTGATTTGTCACTCATTTGTTCCGACCACTTCGACGCttc
gcacaaacatactttgatgaTACTTTCATTCACTTGAAGGACGAAGATGATAGATCTGCCAAAGAAATGCACTTAGAGCACCTCCGTGCAGTGCTAAATG
TTTGCGTGAGCATTCATTGCAATcaaatcttgcaaagtgTACTTTGGATGCTAACGAACTACCGGTCCTCGTTTATTGTGTTGGTGAACACGGTGTTCGC
GCAGACTCTGAGCAGGTCAAAGCAATTGTGGAGTGGCCAACACCATAAAATTAAAATAAGTTAAGGAAATAGATTAATCTGTCCGATTACCCGCATTGCT
TCTCGCGAAAGTACGCACAATTGGCGCGCCCActatcaaacttgctgaagtagcTGTAAGAGTGGCCATCTGTTTGTAAAGAAGCATTCATTCAGATCAA
GAATAGACTGATGATCGCACCACTATTTGCTTTACCAGATGCAACGAAGCCGTGTAGCGTGCTATGTGACGCTTTTGAGCTTGCAATCGGTTGTgcattt
ttgcaaaaaaactTAGAAGGACACAACTGCTTCGTGTCGTTTCAATAACGACAGATCATTTCAGTAGAAAAAAACTACTCCGTATACGACAAGGAGCTTT
GGCAATGAAATATGCCCTGGTGAAGGTTTTTGTTAACCTCTTAGGTTAAATTCCGATTATCGTCTATGTGGAGTTGAGTCGCCCCACTTGTCACAGCGAA
TGGCTCGATGCTTCGTAAAACACGACTATTCGGTCGCGTACAAGCCANNNNNNNNNNA