Description :
From Genome Similarity Track
Location :
Scaffold_64:6165- 8323
Sequence
2158 bases(100 bases per row)
gtcatcgacgcgttcttccgtgcaaagcacgaagccggcttggtgcgtgagagtaagtctccgcactcgacacccacgtctgtgtctgaaagcctaatgg
caagtggcgcatagtgcatgctttcaataagctgaatgcagccaccattccggtgcagagctgattcctagaaagaatgttctacaaaacaacatggtgg
gatgtacgttgtacagtgcactcgacttggtcgacgggtattatcagttgctcatgagagctagcgatatacccctgtcgaacgcgcctgcgacgttcaa
tcgtctagtgacgcagttgttccggccccatcgggcgtacgctcagacgtacttcgacgatatcttcgtccatagtcgtgcggagcacgggaggtctgat
gtggagaaccaccttgaccatttgcgagcggtgctcgagtgcatgcccacgaataagttgtatgccaacttgnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnntccatcgagtccaggtag
ggcgctgcctcggagtttcttccaactacttgcacaagtacagcgagaactacactgatatggctcggccgttgtccaatctccttaagaaggatgcacc
ttggtgctgggatgtcgctcacgacgaagccttcaaggctgttaaggagagtctccttcacacgcccatcttggcgcttccggacccggatcgtccgttt
agcgtcgtctgcgacgcccccgatttcgcaatcggttgtgctttactacaagcaggcgccgaagggcgtgaacgcgttatcgcgtttgaatctcgccagc
ttaaagctgctgagaagaaatacccagttcatgacaaagaactacttgcaatgaagtatgctctagtcaaatttagagtacatctactcggctctaagcc
ctttgtgatctatacagatcatgcgtctttacgcactgcgaatcagtcgcctcacctctcacagagaatggcaagatggctttcattctttgccgattat
aacttcgaggtgaagtataagccgggacggctaaacgtagtggccgatgcgctatcgcgcaggtcggactacgagctgactcatgtcactacagtgacgt
cgtcggtccctgaccttatacgtagggcatacgcccaagacgacacatgtgtagctctggtacgcgctcttgggagcgaagaatgtcacgactcggacaa
ggaattgtcaccgcgcttacgcgcgaggctgcagcgttatacgcttgatcattgcccgctgtactacagcactgaccctgaggatgctccgagtggtcgt
ccctcatgatgaggatcttaagtatcgcatcctctatgaggtgcatgatacgcctgtcggtggacatcttggtcgtgagaagacctatggctcggtgagc
aagatgtactggtggcccaagatatacaagtgggcaaacacctatgtgcgtacatgcgagacatgtcaacggaccaagtccgcggcgcatgcggctgcgc
cgttggcgagtttgccagtcccttcgggatgttggcagtccattagtatggactttgtgtttggccttcctaaggataaggcgggcaacacgggtgtcgt
ggtctttgttgatcgactgagcaagatggctcatctttcggctgtgccgaacaccgttgacggtgaggatacagcgaagctgttcttagatagagtcttt
cgccaacatggcttgcctgaggcaattgtctctgacagagaccctcgctttacagcgaagttctggacgtccttgttcagggtgcttggcaccaagttag
acatgtccacggcggatcatccgcagaccgatggtcaaactgaacgcgtgaatcgcgttgtggaggatatcctccgaagcgtctgcgctgaggcgccacg
acgctggagtgagatgcccccccttgttgagttcgcaatgaactatgcggtgcatgcctcgacaggcttcaccccgttctatgtgaacggtttggtcgac
cctcgcgttcctctaacgccgccacggtgtggctctgggcttgatgggggagggttag