Description :
From Genome Similarity Track
Location :
Scaffold_140:6164- 8117
Transcript NameFunction/comments
Phyta_totarag4401hypothetical protein PHYSODRAFT_557028

Sequence
1953 bases(100 bases per row)
TCTTGAGCAGATTGGTGTGCCATGTGCAGATGGATATCTTCGTCACGCCACCCGTCTCTCGCTTGCGATCCATTCTTCACAGGCATTGATTTTGGTGCAC
GGGGAGGTAGAGAGATCGGACTTGTCGGCAACATTTTGGGGCCGGCAGGAACCATTGGTGGAAGTGGATGCTCCTGAGTAATACGAACACTTCGTTCCAT
CTTTGCCAGCAGTTCATCCTCAATGCCTCCACCGAGCTCAACTTCGTGCGGTGCCCCCTTGCCGTTTTTAACCACCTTCTCCGTAGGCTTCTTTTCCGTC
GTTTCATCCGTATTAACGTCGCCGCGTTCATCAGCTGATGCTTCCCACCATTTATGAATCTCCGTAGAGATCTTCTCGAGATTTTCATATTCAATTCCGT
TGCGTTCGTAGAATAGCAACGTCGGCTGGTAACCTCCCCGTTCAACACGTAGTCGAACATCTCCCCACGTCCCCACAAGTTTGACACGCGTATCATCAAA
TAAGAACCAGCGTTCTCGCTCAACTCCATCCTCATCCAGACTCCGACTGGCAAAAAATCCCACATAGTGACGTCCGTAGTAGCACACAAGTCCCCTGAAC
GAGTACAACGACGACGCCTCCATCGAGTTATCCAGTCGGAAGATGCGTCCTAAGTCCAGAGCTTGCTGAGACTCCTTGTCATCGTCACCCGCCGTACACT
GCGAGGACAGAAGTTCCATCCAGTCCTTGATGTCCGTCTTGTTCACATGGCTACTGGACCAGATAATACTGATGGAAAACACCATGGGCAGCGTGAGGAT
CCACCTGCTCAGTGCTCGTTGTCCCCCTTTCTCACACGCGTCACACGTCCCGGCCACATCTTGTGACTGCGCTTCAAGTCTCAGCACCTCTTCCAGTgtc
atgttcttcttcactccCGTCGATCCAGCTCTTGCAttggtcagcagctcctgagCATAAACTCTATACAGAAAATCCGTGTTCATAATAGGCTCGGCCG
TATGGCCACAAGAAGCACAGATTTTGAGCTCCATCAAGTTCATCTGGAACAATCTGTGGGCCACACACTGCGGCTCGCAGATGATGGCAGACGCGTCTTG
ACGTAGCGACtccgtcatctcctccaccttaTTGATCCCACCAatagcagcagtggctgtGTGTGAGCCTCCTCgacgtagcagcagcatcctgTTGAAT
GTGTCGTAGTGCAGAGCGTCCAGGATGgcttccagcgtctccgtAGCGTCGTTCATGGCGCCCAGAGCGAAGGTGTCTCCCAAAGCGAGACGCACACggt
ccacgtccagcactgGCTGCTCTGCGAACTGGTACATGACGAagatctgctccagctcgcacAAGAGACACGGAGTGGTGGTCTCGGTCTGAAACGCGCT
GGCGTTCGTGGGCTTCCCGCCGCAGCGGTGATGCACTGCGTGGTCGCCCGTGGATATGAGCACGCGGCAGCTGCGCACGTGCCATAAGCTCTGGATGATG
ACGTTCAGGAAGCAGTTGTTCGAGCCCAAGTCGTTGCGCAGACCCTTGCGCGCGCTCAGAGGCCGCGACGAAGGACGGTTCAGCATGGCGTGAATTATTG
ACTCAAGTTGAGTATGGACGGGATTTCTTCAAGATGGTCTTGATTAGGCTAGGCAGATGTCCTAAGATAGAGTGTCTTGACTAGAGTAGGGTATTGTGTC
GTATATTAGCGTTATGGTCCCGTAGATAGAAACGATACAGGAGTGAACGGCGgccagtacatgtacttcaaaAGTAGTTCATATAACCTAAGACGAAGCC
TGTCTGGCTTGTGTTAGTTGTTTGGCTGAGCCGAGTGGTGAGGTAGgatttacatgtacagataTGGATGTTGGTTGTATACGTGTGCACGACTGCTACT
CGTGAACATTTCCTCTGGTCTGCGCAAGCGTATTTGGTTATTCGTCCGCATCG