Description :
From Genome Similarity Track
Location :
Scaffold_17:616394- 621167
Sequence
4773 bases(100 bases per row)
GGAGATTCTCCCCCACTAAAGGTGGAGCCGCCAGCATCCGTGGGGTGGCCCATAGCGAGAAGTGCCGGAACACGTGGGTGTCGTGCGCTGTTCACAAAGA
ACGGCGTCAGGCCCGTCGAGGAGTGCTTGGCGGTGTTGAGTGCGAATTCGGCTAGCGGTAGGAACGAACTCCATCTCGTGTACAAAGTCGCGTAGCTGCG
GAGAACGTTTTCAAGGACTTGGTTGACGCGTTCGGTTTGTCCATCCGTCTCCGGATGCGCCTCGGTCGACATCAGCAGTTTAGCTCCCAGGAGCCCGAAG
AGGCGTGACCAGAACGCGGATGTAAGCCGCGGGTCGCGGTCGGATATGATAGACTCCGGCAGGCCGTGGTGACCCAAAATCACGTCGACAAAGCGGGCCG
CGGACTCCTCCGCGGTGATCGAGGCTGCCACAGGAACGAGATGGACCATTTTGCTGAAACGATCGACGAGCACAAGTACACCCGTGCGTCCGGCTGTATC
GGGCGGAAGACCGAAGTTGAAGTCCATCGAAAAGGAGCGCCAGGCTTTCTTTGCGACCGGAAGAGGGCGCAATGGGGCCTGAGACGTCGAAGACGGTTTG
ACTCGCTGGCAAGTTTCACATGTGCCCACTTGCGTACCCACTTGTACATATGTAGCCAATAGAAGTCTCTAGACAGTGCCGCGTACGTCTATTCGCGTCC
GAGATGTCCTCCAGTTGGGGCGTCATGGTACTCGTGGATTATACGCGCACGTAGTTCAGCGTCGTTTGATATGACGACTCGGGATCAATTAAATCTGTCG
GTGCTGTACTTCATCAGATTGCCGTCCGGTCGGTATAGATCGATCTGATTACGCGTGGACCTTGTCAGAGCACTTAGCGTGTTGCTATTAGGAGCGCGCA
GGTGTTTCAAGATGGCACCGTATATAGGATCATCAGCGAACACAGTGTGGGCGTAGTCAGTATCAGGTTGATGCCTGACGACACGCAAACCGCACATTCG
TCATCATCCTCATCAGCCATCTGATGTCCTAGCGCTTCACGGGGTTGTAGTCCGGACGTCGAGATAGCGCGTCGGCGACAATGTTATTCTTGCCCGGCTT
GAAGTGAACAACGAAGCTGTACTCGGAGAAGAAGGACAGCCATCGGGCCATCCGTTGCGACAAGTAAGGGCTCTTCATCGCTGTCCGCAGCGATGCTTGA
TCAGTGTAAGCCGCAAATGACTGTTCACCGAGCAAGTACACTCTGAATTTGATCAGAGCGTACCGTATTGCCAGTAGCTCCTTGTCGTGGACTGGGTAGT
TCTTCTCGGCTAGCTTCAGTTATCGCGACTGATAGCTGAAAACGCGTTCATGTTCGTAATCATCGAACTGCATCAGCGCACAGCCGATGGCAAAATCACT
CGCGTCGCAGACGACATGAAATGGCTTTAAGTGGTCAGCAAGGTTTAAGATTGGTGCAGACGCCAAGCTCTTCTTTACCGAGACGAATGCAACTTGGTGG
TTAGATTTCCACTCCCAGACCACGTCCTTCTTCTGCAGCGAGGACAGCGGCTGGATCAACCCGGCGTAATTCTTCGTATGCTTGTGCAAGTAATTGGCCA
TGCCAAGCCACTGACGCAACTCAGGGGGGCTTGTCGGCGTTGACCAAGCACAGATAGTCGAGCCCTTCTCGGGATCTGCGCGCACACCGCTCTTGCTCAC
GTAGCATCCCAACACCGGAATCTCCGGTACACAGAAGACACATTTCTTCAGGTTTGCGTAGAGCTTGTTCTCTTGCATCACCTGGAATACTTGCCTCAGG
CGTTTTAGATGTACTTCCACGGCACTGAGGTTGCCCTCAGAGAGGCTGTGCACGAAGATGTCGCCGAAATAACTCGGCGCGAAGTCTCAGAGCGGACAAA
GAACATGGGAGACCATGCGATTGAAGGTGGCAGGCGCGGTCTTCAGACCCTGTGGCATCACGAGCCGCTCCCAGAGCATACCGCTCGGTGTACTTACGGC
GGTCAGAGGCACATCACATGCTCTCATCAGGATATGATAGAATCCATCTGTCAGGTCGATGGCGCTGTAGATAACGCTGCCAGCCATGACGTCCAGTACC
ATGTCCTTCCGAGGGATCGGAGTCTGAGCGGGGATGGTGGCATCATTCAATTTGCTGAATGCGTGAGCAATGCGCCTCCCCTGTAATTTTCTTTACACAG
AACGTTGGACTTGAATGGGGCGACGTACTCTCGCGTACGTGACTCGCCTTTCGGCGGCCCTCAAAGAAGTCATTGATCGCTTTCACTTGATCACGGGGAG
ATGGCCATTGTCTGGTGACGCAGTACTTCGTACCTGGCGCGAGGTCGATCTCGTGTTGAGCCCCACGATCCGCCGGAAGCTTGGCGGGGATCTCATCCGG
GAAGACGTCGGCGTACTCGCCGACGTACACGGGATTCTCTGACTCCCACAAGGCCTCCCAGGACTGCGTTTGGAATCGTTCCTCACGAGCAGACTTAGGT
TCAGCACCTTGCGGATGTAAACGTTCACTATCCGTTACGACTGCGTTTGCTGACTCATCCACCGAGACTGCCTCGGTGACCAAGCACACTTGCTCGACGT
CTCCAGCTTTGAGGTCCCGAAGAACGTTCTTCCAGGACAAGCCTGGAAGGCGTGTGATTGCCGCCGCTTCGCGCGGCAGACTCGCGACTTCGATAGTGCA
CGACCGACTCGGGCCTCCTTCCACGTACTCGAGCGCGCAGACTGATTCCATCGGCGGGCTATCGCTGGTCGTGGAGTCCCGACGAGGCTTCAGGCGTCGT
CTCTTCGGCTTCTTCTTCGGCTTCCTCGAGCTCACGCTCGAGTCTGACTCACTGCTACTCGACGATGCAACACCCTCCTGTAGGCGCGGAAGACCGCTCT
CGACCGGGCCGGGAACACGCAGGGGCCCCTCCTCAACCGCCGCATCGTTTGACGGGAGCCCAATTTGCTCGACCACCGTCTCGTGTTGTGGGAGCCCCAG
CTCGACCACCGTCTTGTATTGTGTGAGTCTCTGCTTGACCACTTCATAATCTACCTCGCGGCACCACGAGGGCTCTTCGTCCAACAATGTAACGCAAGCA
ATGCAGAGAGGGCCATCGCTCGCTCTGTGCACTGTCTGTGTCGTTGCTGTTTTGTTCACGACTGTGACGTGGGGCCAGACTCTTGGCGCCACCAAGAGGT
GTGTGAATACCTCGCTTACGTCGAATCCACGTCGACGCTTGACCGATTGCGTCAGCCAGTCGATCTCTGGCTGATATCACGCAAGCCAAGGAATACCCAC
GATGCAGTCAAACGCATAATTCATCTCGATCACCAAGAAGTCGTCCATGCTACGGAAGCCGTTGAACGTGTAGGACAAGGACACGTCACGCCGCGCAACG
CGGCGATCCTTACCATCTGCGAGTTTGACTTTAATATTGCCCGGATCATTCCGTACGCGGACGTTGTTGGGTAGTACCGACAAACACGACGCGCGAAAGA
AGTTGTTGGTCGCTCCTGAGTCAAGGAGCGCGCGCAGTGGTCGCCGGGCACCGGTGACGTGGAGACTGACTACGATCAGTCTCGACGTAGTGGTGTGCTT
GGAGCACGAAAGGGCTCGAAGATTGGGCTGCCACCGTAGGGCCCGGTCCTTCGTTAAAACCAGTAGCACCTACTGGCCCTGGTTCTTTTTTTTAAAAGCG
ACCGAGGAATGTTCTGCATCGGTGTGCGCGACGACGGGAGCTGGCGCGCGGCACTCCTCCGCGCGATGCCCTTTCTTACCACAGCGAAAGCAAATGAGGG
AGCGATTGCTTTGCCCACCGCTACCGCGGTAGGACCCGCGACGTCGATCGCTCGACGCGTTGATGGCGTCGATCTCCATGGACGCGGGGGTAGAATCTCG
GACTTCCGCAGGTATGGCTGCGGCGTACGATGCAGCGACCCTGTAATCCTCGCGAATTGCGAGTGCAAATGTCTCTTTGAGGTAGGAGGGTTCAGCTCTG
GTAAGGCAGTAGCGGGTCATACCCTCGAGCATGCCGAACACGAATACGTGAACTTGCGAGGTCATGTCGATTGGTTTGGTCACGATGCATGATGCCAGAT
GCCGCACCTTCTGAACGGAATCTCGCATGGACATCTTTCCTTGCCGAAGAGCGAAGAGCTCTGCACGAGCGCGCGACTCATCTTGCGGGGGCTCGAACGC
AAGGCGCAAGTCGCTCTGGAGAGTTTCCAGAGCTGGAAAAGCCTCGGGGTCGACAACCAGCTTGCCAAGGGCCCATTCGCAGGCCTTTCCGGCTAACCGG
GAGAGGAGGAAGTTTACCTTGGCTGATGACGCCTCGATGCGTCGCGAGGCGATAGCGATGTCGATCTCGCGGAACCACCGGCTTAGCGGGAGCCGGTTTC
CACCGGCGCCAGAATACGTAGACGTCTCCATCTTGACTACGTCATTCTGGGATGGGCGCGAGGGAGTTGACACCCGCCAATTCGCATCGGCGAACTCGCG
TTCCATGAGCTCTTGTGCTGCAAGACATTGCTGGTCGGGCGTCGCTAATCTCAGCAGCGATGCGACAACAGCATCTCCGGACACCGTCACCAGGCGGTAA
AGCGTTCCCACTCCACGCAAGTGAGATGGGGGAATGCAGCATGCTTCAGGGCCGCCCTGGAGATCTGGACTTGGCTCATCGTAGACTTGATCGCTGGAAA
GACTACTTAGTGCTACCAGGTGTAACGGGGATAGCGTTGCCATCACTAGCTTACACTATAGTGTGGAGGAAGC