Description :
From Genome Similarity Track
Location :
contig_93:61633- 63332
Transcript NameFunction/comments
g10772.t1conserved hypothetical protein
g10773.t1hypothetical protein

Sequence
1699 bases(100 bases per row)
GTTGGGTTCGACGCGAACGAAATGCGCTGAAGCCGCTGCTCGTCGTCGTCCCTGTGGCAGAAGCAGTAAGCATTAGCGGAGCCCGTGGTGACTTACCGAA
CTTCCTGCGCCGCCCTTTCATGATCACGTGGCAACGTGTAGCCGGTCCAACATGTAGTCATTCTCCGAATGGCGTTGCTGCGGCTGCATGGCTCAAGCCG
CATCAAGCGCATATGAAGCATGCAATGAGCCAATGGACTTCCTGTGAGAAGAGAAGTGCTGGTCGCCTCAATCTTTAGTTAGCGCGACTATTTTTGCTTT
TAGCCGAGGCGTCTGAGCCTGGCCTGGTGGCGGAGGAAAAAATAGCCTCTTTGGTCGGCGCTGGCGTGGACGACCAAGCCCTGCACGCATTTCTACTGGC
GAAGGCAGCAATTCTTGTCACAGCTGGCTCAGCGTTGCCGCCCGTGCATGCAAGTCGGCGCGGGTCGGACGTCTACCTGCAGCTAACACTCTCGACTCCT
ACCTGTCAGGGGATGCCCCACGCCTAACGAACTTCTTTTCGACTGCCAGTTGCGACCTTTTCGATGGGCGGCGGCGTGTCCAAGCACGAGTATGAACGCA
TTCGCAAGGAGCTGATGCTCAAGGACCAAGTCATTCGCGCCTTGCAGGAACGACTGGCCAATGGCGGCTACATTGGTCCGATGCACGCATCGCCTGGTGG
CGACTCGGATGAGAAGGTAACGCCTGAAAGAGCTGCAGCGGCAACGATGGTGGCAAAGGTGAGGGGCAAGGAGAAAGACAAAGAGTCCCGCGTGTCGAAC
GCCGAACATACGCTTCAAAAGGGAGGCAGCTTCAGCTCGCGGTTCACGTTACTTGACGAGGCAAAGGAGTTGCTACGAGATAGCATCGATCACTCTGACA
GCGACGCAAAAAGTCGATACAACTCGACGGATGAAAATGGCGGACCCGATAGCAGCGGGCATACCGCTGGGTCAAAAGGCAAATTGCGCCGTGTCGAGGT
TAGTGCTGAAGTCATGCCAAGTCGGAAGATCATGTCGACAAAGGAGCGCGTAGTATACCCGAAAGGAGATAGCTCCAGAGAGCTTCTGCTCAAAGTGCTA
CAATCGAACGTGCTGTTCAAAGGCCAGTCGTACGGCGAGCTTCGAGATTGCTTGGACGCCTTCTTCCCGATGCGCGTTGAACCCGGTCACTTCGTGATCA
AGCAAGGAGCGCAAGGAGACAACTTTTACGCAGTGGAAAGTGGGCAGCTCGAAATTCTAGTGTCAATGGGCGAAGCACCACCGATCCGCTACGGACCTGG
GTCCTGGCTTGGGTTTTGGCGAACTGGCATTGCTCTACAACATGCACGCGCTGCCACAATCCGTGCAGTGACTGAAGTCGAGCTCTGGGCTCTGGAGCGT
AACACTTTCAGGGAGATCCTAGCTTCGCACAAGCTTAATCGTCTTCACCGGACACTTGAGGTTTTGGAGAAGGTTGCGATACTCAGCAAACTTACCTCAT
CCGAAAAGCAGCAGGTTGCAGGCAATGGACTGGGAGGAGTTTGAAGGGAAAGCTGCAATTGTGCGCAGGGAGAGGTTGGTGAGAAGTTTTACATCATCAC
CAAGGGCGAGATTGTCGTCACTCAACTGGACGCCAACACGAGCGAGGAAAACATTATCCGAAGACTGAAGGCTGGCGATCATTTTGGTGAGATGGCTCT