Description :
From Genome Similarity Track
Location :
Scaffold_571:6163- 7710
Sequence
1547 bases(100 bases per row)
TCTTGGACTTCAACAGAGTGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCAGTGATCCTAGGACCT
TAGGATTAGCTTCCAGCCTGGCCAATGATACCTGGTGACCCAGGTNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGCGGTAGCATCCTTACCC
GCGCCGATCTTGAGATATCTATATAAAGTGTCATCAATCAAACGCTGATATTCTGTGGAGTGTTCTTCAGTCCAAAAGGCGTCCTNNNNNNNNNNCCATG
ACGCAGCTGGGATAAATATACCATCAACATAAGATCTTCTGCACTGACTGAGTCTAGACGGTTTCTGGTTCTTCAGTGAACACATCGGTCAACCTAGAGG
AATTNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNAACCATCAAACACTGTCAATTTTTAAAAAGT
TCCAATTGATTATTAGCTGATCCACTCGTCGATAGCCGATACATAGTCGGNNNNNNNNNNCTTTTAATGATCACGGCTATTGGTACAGCCCACGGCGATG
TCGAGGTAGAATAAAAAAAATATTAGCCGACAACAGACCTTTTATCAGATCGCTCAACTTCTCACGAAATTTTTTGGCGCAAACGGTCACACGCGCTGCG
CGATCGGCCTTGTCTCTCCAACATCAATATCACACATGGTCCCACGTACTGCAGGGGGTAACGCATTTCTTTTCCCAATCAACAGGTGACGACTCTNNNN
NNNNNNNNNNNNNNNNNNNGATTTTCTGATAAGGGTATTCCAGGATCGCCGACCTGGACATCGTCTATCGTTATCTCCGTCGTAGATGTTTNNNNNNNNN
NGAGATATCCATACAAAGCATTATCAACCAAACGCTGATAAAACTGTGGAGCTTTTTCCGGTCCAAATTGCATCCTCAACCATTCNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN