Description :
From Genome Similarity Track
Location :
Scaffold_844:6162- 8185
Transcript NameFunction/comments
Phyta_totarag10982hypothetical protein PHYSODRAFT_247331
Phyta_totarag10983hypothetical protein

Sequence
2023 bases(100 bases per row)
AgtcctcgtgctgctccaACGTTCTATGTTCGAAAGCCTGTCGGATGGCGGATCGTACACGACTACCGGTACTTAAACTCGAACACGATTCGCCAGAGTA
TTCCGATGACACGAAAGGAAGACATCCTGGACGCCATGTCCGGAGCATACTGGTTCTCTACGATGGACCTGATGTCTGCGTACTACCAAGTGCGCAtgcg
agaagaagacatcAAGTTCACCGCGCTTCAGGCATCTAATGGGTTATGGGAGTATCTTGTACTGCCCATGGGAGTCTGCAACGCACCAGCGACGATGCAT
CGGTTGACATCTAAGCTATTTCGTGGTCAGGAGAGCACGAAGTCGTTCTACGATGACATCTACATCTTCACGAAGTCTCGCAACTTTGAAGATCACTTGG
AGGCCCTGCGTAAGACCTTGAACATCTTGCGCAACAACACGCTGTACGTCAAAATAGCCAAGTGTGTCTTCTGTGCGGACGAGACTCCATGCTTGGGCGA
CTTTGTCGGACGTAACGGTGTGCGTATGGATCCTAACGAGGGACAGACAATCAAGGACTGGCCGGTTCCTCGAACACAAGAAGAGCTCAACAGCTTTCTG
GGTTTGACCGGTTACGTTCAGCGATTCTGTCCGGAGTACGCATCACTAACTGCGACCATGTTTGCTCTTCTTAAGATGAACAACAAGCGTAACGCGAATT
CAATTTGACGAGGAGCAGTTGACAAATTTCATGGAGCTGAAACGAGGGTTGTGCAACCCACCAGTACTTTACCTCCCAGACTTCAACCAGCCAATGAATT
TGCGTACCGACGCGAGCAAGGTTGCTGTTGGCGGAGTGTTGTTccaagtcgtcgatggcgtTGAGCGTCCTATCGCGTACACGAGCCGAAAGATGACATC
GGCGGAGGTCAACTATCCgacgcaacagcaagagctcTTGACAATTGTCCACGCGCTTGCAGCTTTCAGGATCTACTGCTTGGACAACCCACCCATTGTC
GAGACAGACCACAAGAGTCTCAATAGACTGTTCACGCAGAAGATGGCTAATCGTCGACTTTCGCGCTGGTATGATATCCTCGCGGAGTACCAGCCAACTT
TCTCGTATCTTCCCGGTGCGAAGAACGGAATAGCCGACGCGTTAAGCTGGAGACCCGACCCGCAACCGAAGGCGAAGTTCTTTCATGGCTTGAGCGTGAC
CAGCTTCGATGAGACATCGTTCCACTTTGCGGTCAGCGAAGTGACCACCAACTTTAAGCAAGTTACAAGTTACAagcatcaagaaggcgtATGCGAAAGA
TCGTGAAGCGCAAGCCATATTCGCTGCAATCAAGCGACGTACAGCCAACTTGAGACCCACGCGTGAGCGCCAGCATCAGAAGAAGTACCGATGCTATTCT
GAGGAAAACGGCTTGCTCTGATATCAGACGTCAGCGGATGATGCCCCACGCATTGTCGTTCCAAACGCCGTGAAATTGCGGCAAACAGTCATCAGTGAAT
ACCACGATTCCAACTACGGCGATCATCCAGGCGCGGAGCGTACGTACTTGACTCTTGCGCGACACTAGTATTGGTCTAAGAGGTTGAAGTCGATTCAGAA
GTTCATCGCTGACTGTGAGCCGTATCGGCGGAACAACCTCGATTAAGCAAACCTCCTGGCTTACTTGAACCATTGAGCATACCGACGAACGGTGACGATC
AATCTCCATGGACTTCATCACCGATCTACCATGGACCAAGAGTGAAGTTGACTCCATCtgggtcgtcgtcgatcGACTGACGAAGCGATGCCACTTCGTG
CCAACAATCAAAACGGTGACAGCTGAAGGTGTTGCTCCTCTCTTCATCGACCACATCTGGAACTTGCATGGCATGCCGACGAACATTATATCAGATTAAG
ACCGGAAGTTCGTGTCTGCGTTCTGGCAACACGTCTTCAAGTCCACCGGGACTAAGCTGAGCATGACGGTAGCGTATCGAGAGCAAGGGGACGGTCAAAC
GGAGCGCATGAACCGAACCCTGG