Description :
From Genome Similarity Track
Location :
Scaffold_708:6160- 8690
Transcript NameFunction/comments
Phyke_g10797arginine biosynthesis bifunctional protein argJ, putative
Phyke_g10798hypothetical protein PHYSODRAFT_307583

Sequence
2530 bases(100 bases per row)
ACTTACGAGCGGTAATCCGCGTTGATCGCCACATACTCGTGCGTAAGGTCAATGCCCAGTACCTGTGTCTCCTCGGATCCAACACCCAGGTCAATCTCCA
TCTGTGAATACGTTCACAAAATTCGTTAGAATCGAGTTGTGGCAATAATCACGCTTACTAGTGTGGCAAATATAGTGGGAATCACATACCTCGACAAACT
TTCCGTGCGGAGGGTAATTGTGCGAGCTGGCATCGAGGCCACCACGGGTGGGTTCAATCAGCATCGCGTCTTTCATGTGCTTCACAAGCTTAacttcatt
gtcatcgttgaGAATCATCTCGCCATTCTCAAAGATTGAAACACCACCCATACGGATGGACATACGACGTTGAATGTTCACGTCCTTGTGGTGGGTACCC
ATGTACTTGCCCACAGCCATCACTACCCGACCCACGTTCGGGTCGTTACCGGCCACAGCACATTTGAGGAGCGGAGAGTTCACGACGGATTTGCCGACAC
CCTTAGCCATCTCTTTGGTTACGGCGCCACGGACGCTCACGCGCATGACGTGGTGCGCACCCTCACCGTTGCGCACAATGTCTTCACTCAGTCCCAGGCA
CACCTCCTTGAGAGCCgccttgaactcgtccagcagcgccatgtCGAAAGGGATCTGGTCCGACGACACCAGCGTCACCGTATCCGACGTGCTCTGGTCC
GTGTCCACACTGAGAGCATTGTACGTGTCCGCGACCACCTCCGTCAGCAGTTGGCGCAGCACATCACGCGGTACTGAGAGATCTACTCGTACAAAACAAT
CGTTAGACTTAATTTCTAAGATAAGAAAATCACTTGACAGCAATTATACCCGTGAGGATGTACGACAGCATGGTGGCCATGTTGGGCTCAATCATTCCAG
CACCCTTGGCAATACCGACGATGCGGCCACCACACACGTCCATGGAGCGGACCTTCGGGTACAAATCTATCCTCAAATAACAACAAAATTGCATCAGTAC
AAATGGCAACTAAGCAATAATGATAAAAACAAATATCCTTCCTACCCGTGGTCATAATTCCCTCGGCAGCAGGCAGCACTGAGTCTGACTGCAGATTGGA
CACCAGCTTTGGGAGGTTCTCCACCATGTCGTCAACTGGAATCCTCCAGCCAATGACTCCAGTGGAGCACGGTAAGACTTGGGAACCAGCCTCCAGTCTC
AAATGCTTGGCCAGTTGTTCACAGACTTCCTCAGCATCAGCGACACCTCCTCCACTTGCACAGACATTGGAGATCTTGTTATTCACCAGAATCGCTCCTA
ATTTCGGCTCTTGAAGACGTTTGCGGCCTACAAGCACTGGAGCTCCAGGGAAGGCGTTCTGCGTAAACACTGCAGCGAATAGGGACGTAGGCTTCACTGG
TTTGATGAGACTCATCGTCATCTTGGCTGGCAAATGGGGTGCTTCAGTCGGGACAAAGTCGAACCGCGTGGTGGCCACAGAAAACCCCCAGGGCAGACGA
CTCTGATGGGTCTCGAGATACTCCATATACTCATGACGGGAGTCGAACACGAACGGATGGCCGTTGGTGGATAGACAGCGAGTCTGTAGCAGCACACGCG
ACCGAGAGAGAGACGACAGACGTAGGAGTGCCATAGTACTGTGGCTGGACAGGAACTGGACTGGTTGGGAGTGCTCCAATGAGGATTTAACTGCGGAATG
TTCCTGTGGTCGACCGGTAGCGAAGATCGGCAGATCGCACAGACCTTACTGGGATGCAATTAGATATGAAGCTAACGTTCGAATACGTTTATACTGTAAT
ATGCAATTGGTGAGAATATGGCACACTTATATTTGCATTTTGTTGACTTTATAGTCCGAATTATTTGTTCTTTACAAATTCTGGTACAAATGTATCTGAG
ATGGAATCATTAGCTTCTTTGCGCGATGGCAGACGTTGCGGACGGGAACGTGTCCGAAGCCGCTTCCGACGCGCCGTTGCCTCctccgccgccgcctcca
cctcctcccCAACTGCGTCCTGAAGAGGAACTCAAGCGGAAGCGCCAGCAACAGAATCAGTCGCTGAAAcccaagcagaagaaggacttTCGGGAGATTC
TGGCCCTCTTCCACGACGAATCCATGGACGAAGCTCAAATTAAGCGCGTGTGGGGAGGACTGTGGCAGACAACGCTGGCGGAGGCCCAGGAGGAGCACAA
GCGACGTCgacaacaggagcagcagggACTTAAGCGAAAAAAAGACGGCCTCACGCCCCCCAGATCAGGCTCCATTCGCCACGGAGGAGGACCGGACCAT
CTCAAGCGCACTCGACAGGTGCTGCGTCCTTATAAGACTGTTATTGTTTGATGAGAGCTAACTCTATGTGGTTTTTATGTTGCTGGTTGTAGGGCTCTGC
AGCTAGTACGGACTCGTCCGAGTCTGGGAAGAGCCGTCTCGGAGGACGATTCCAGAAGACCGCCCCGAAGGGATCCAAACTCATGCAGAAACTCGGTACA
AGAGGAACTTAAATGTGAGTAGAATATATA