Description :
From Genome Similarity Track
Location :
Scaffold_729:6160- 8229
Sequence
2069 bases(100 bases per row)
GTCTCTTTGTCCTTTGATTCGTGCCAGCGAGAGCCAAGAGGCTTTGCTGGTGCTCTCGGCTTTGAACCGATTCCGAAGGGTTCATCGAACTGAGTTGAGT
GGCTATGCGCTCGTGGATGAGTTTTGCGAACGCATTTGCCGACGGCAGGTACGCATCTTTGAGGCTGACCTTGGTCATGCTAGCTGAGTCACTATGTTCA
TCACCACAGTGCGGCAAGTCCTGGTTCCACCTCGCTATGAAATCTCGCAGCATGTCAGCGTGGTGCTGATCTGGCGTTCCTTCACCGTTTCCATGCGTTG
TGGTCAAGTTGAGGTCGATCAGTGCTTGCAACTGGGCAATCGCTCGCTCCGCATACCCTGCTTTTTGCTCCAGAACGCACATGCGCAAATGGAAGTCAAG
CAGCAACTCCACGAGTCCCTGTGCTTTTTCGGAAGCTGCGACCACTTGATCAAACGAGACTGTAGGTGGCGATGCGAGGAGCGAGCCAGAGTCAAAGATC
CGCACTGAAGATGACGAGGAACTTTGGGAGGTAGTACTTGACTGGGACTTGAGCTTCTCTTGTTCCTTCGCCATCTCTTTAAATGCCTCTTTGCGTAGAA
TCGCGATGATCCGCGCGTATAGATCTCGCAGCAACGGCACGGAGAAGCTCGCGAAATTCTGCTGACTTGTGCGCAACAAATGGCTCCAGAGGCTGCCATT
TGTTGGATCCCGCTCAATCATCTCTTCCAATTGGCTCCGGAGTGTTTCGTGGTCTCCTCTCACTGTATTTGTCGCTCCAGTGTTGCTGGTGGTGTTGCCA
CCAAAGTTCAGGTTCCGGATCGAGAGGTTCAGTTCCACGAGCCGAAGCTCGCGGTTCCCTGGATTCGCTTCAATCGCCTTCTTGAGAATCGCAATCTGCT
TCTCCACAACCATTGCTGATGTTTGATTTTTGCTACTAGCCTTGCGACGCGTCAGTCGAAGCGACTGTTCCTGGAAGGCGATGAAATCGAGCCACGTTGC
GATATCTCGAGGGTTTTTCTGCAGCAACTCATTGAAAATCTTGCTCCTCGTCACGAGGTACTGCTCGACATTCGCTGTCTCCGTGCGCAGCAACTGCAGC
TCTTCTTCCCTATCGTCATCCTTTTCCAAACTCTGGCTGATCACTGGATCGAGCGGGATATACGAAAGCTCTGCCGCAACTCCAGACCCAGAGCTGCTCT
TGCTTTGCTGCTGCTGCTGTCGTGCAAGACGCTTCTCTGAATACGCCATATACAACCGCCTCTGCCTCGAGTCCTTCTCCATCTGTCGCGCACTAACACC
AAAATAGCGATGCTCCGATCCCGCTGCTTCTTTAGCTTTCTTCGCTTGATCTAAAGGTCCTGGACCGCCATAGTTCTTCTTCCTTTCCACGAGCCATTCG
CCAGTGAACACGTTACGGCGCGTCGCCAGTGCGTAAACGGGCTTGTCCTGCGCGTACAACGTGCCATAGAAGCGGTTTTCGCGGTCGCCCGCGCAGTCGA
ACTCAAACAGTTTGGTGCCGTTCGCGTCCTTGTCGTTCACTGTCGCCTGCTTCATCCACATTTGAACTTCTTTTGGGGCAGTAGCCACCAGTTGGTTGTA
CTCGTATGTGTCCTGATCACTCGCGCGCAGTCGCTTGCGCTTGTGCTTATGCTTGCGGCTAGAGTCGTCATTATCGCTGTTGCTGTAATCGCTGTGTCTC
CGTCTTAAAGACGACTCCTTCTTTTTCTTCGAGTCTTTTTTCTTCTTCAAATGGCGCTCTTTGTAGCGAAAAAGCTGCTTTCCTTCATCGTCAAGATCAC
TTGTACTGGCGCTGTTGCTGTCGCTGTCGTTGTTCGAAAAATCTTGTCGCGGTCGCTTGTGACTCTTTCGCCGTTTACCTGTTTTGCTACTGCTACTGTC
GCTCTTGCCCTTCTTCTCCTTCCTGCTCTTCTTGTCGCCCTTGCGATACACCTGCAACGCGGAGCTCTCCGCAGCAGCGTCACGCTCATCTTCTTTATCG
TGGCGAGGCTCGTGGACAAAACTCGTGCCGACCTGCAGCCAATCTACACGCATACACACACAACACACA