Description :
From Genome Similarity Track
Location :
Scaffold_2811:616- 2078
Transcript NameFunction/comments
Phypl_g15409reverse transcriptase

Sequence
1462 bases(100 bases per row)
GCCGTAGCACGGGCGTTGtcgcgatcttctccttcaacTTCCTGAACGCCCGGTGCGCATGGATCCACCGTCTATCCACATCAGATGAGTCCCGTACCAC
CTGATCTACTGATACCACACCTCGAGCTCCCAGATCAAGATCTGCGGTGTCCCGATCGGGGGTCTCCGCTTCGAGAAGCATCGTGATCAGGTCACTAGCC
TGCTTCTTAGTCATGGCGGCGAAATCGACCTCCCGCAACTCGTACAACACCGAGGCGTAGATCGCATAATCTTCGATAAAGCGGTTGTAGTAGTTCAAGC
TGCCCAGAAAAGATTGCATAGATCGTAGTGAGCCCGGAAACGGTAGATCAGTCAGCGCGGCCAGATCCTTAGGCTTCGTCTCCAATCCATCTTTTGACGC
GCGATGCCCAAGGTACTCCACCTTACTCATACCCTTGAAGCTCTTCGCCACGCTGACCGACAGATTCTACTTATCGCACGCCTCCAGTAAGGCGTCCACC
CGATCGCACAACTGGTTCCATGATCTAGCCGGTACCAGAATGTCGTCGATATAGGATCTTCGTCCTAGCACCGGCGATTTACCCGGATCTTCAGGCTCAT
CTGGTTCAAGCAGATCCGCTAATCCTGCATCAGCTCCAGATCGCGGGATCTGCGTAAATCCATACAACGCATTATCGACAAGGCGTTGATAGATCTGCGG
GGCGTTCTTGAGGCCGAAAGGCATCCGACTCCACTCGAAAAGCCCAAATGGGGTGATAAATGCCAAGATCGCACGAGCCTGACCCGTCATCGTCACTACC
CAAAACCCGCTCGCCATGTCCAGCGAACAATACCACAGTACTTTATCCAGATCTTCGAGCAGATCATTGATTAGAGGCATTGGGTAGATCATCAGTCGAG
TGAGGCTGTTGGCCAGTCTGTAATCAATACACAGACGAATGTCcacgccgttcttcttgacgatcaCGACAATTGGCGAAGCCCATGGTGACGTAGAGTG
ATGTATGATCTTGGCCCCCAGTAATCCCTTGATCAGATCAGACAGTTTCTCTCTGAACTGGGGGGCCACCTTACGCACCCGCTGCGCGATCGGCCTTGCA
TTACCTACGTCGATGTCACACACGACGCCTCGGGCTGCTGGAGGGAGCGCATTACCCTTCCCAATCAGCAGCTGTCGACATCGCCAGATCCGTTTCCGTA
GTTGATCAATCTCTTCCGGAGTGTTGATCTTGGGGTCTCCCACTTGTATATCTTCAATCGtcacctcgtccgtcgtcTGTGTCACTTTCGGCAGCACTGC
CAGTTCACCTTGCACGTCCTCCGCGATCAGATCTCCACTCTCGTGGTAGCAGATCTGCTCATCCTCCAATAGTCTGTCTAGGCTGTGATCTGGGTCGGGA
GACACTATCTGATTTGCCGGATCCTGATCCTGATCTCTATCCGGTCTCTGGTCACCACCTGA