Description :
From Genome Similarity Track
Location :
Scaffold_24:615968- 618668
Transcript NameFunction/comments
Physo_133195hypothetical protein

Sequence
2700 bases(100 bases per row)
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGATCATGTTGTACAGACGTTTCTCGCCAGTCACAAGCC
CCAAAATGCTGATGATCCTCCTAATTATGAACAACTTGAACTCGCATTGGAGATGGCTTACGACCATCGCCAAGGTCGGAAAGCAGAGGGCGCCAAGGAC
AATGATGATGAAGAAAAGGCGTTCTTTGCTGGTGGAGGAAGAGGTCGAGGACGTGGTCGCGGCCGTGGACGTGGTGGTCGATCTGGAGGACACGGGCGCG
GTTCCGGTGGTGGACATGGTTCTGGCGGTCGCGGCAGCCAAGGTGGTGGGCGTGTAACTGGACGTGGCCAAGCCGGCAGTGGACAAAAGCCAGGTGGTGC
TTGTTATCACTGCCATGAAGCAGGGCATCATGTGTTTGATTGCCCGTTTCTTGGCAACCGACCTCCAGCCGAGGATCGCAGCAGCACCCAAGCTCAGAAG
CGCGTGAAGATGAGTGGAGGAAAGAGTGCTAAGGCTGCTGAAACGAGTAGCTACGCTAATGAAAGTGATGACAGCGCGTATGTTATTCTTCAAGTGATGA
AAATGAAAAAGCCGGTCGCAGACAAAGCCCATGATAACTGGTACCTGGACTCTGGTGCATCGAGTCATATTTCGAACCAGCTCACTGATTTCATGGAGTT
CACGCCTCTAAGCGCCCGGATTCGAGTTGGAGGAAAGAACTCGCTGGGTGTTGAGGGTATTGGTACTGTGGTTAAAGAGCTGGAGACTACTGGTGGGAGG
TGCTCACTGACGCTGCGAGGAGTTCGTTATGCTCCAGAGCTGCAGTGCAGTCTCTATTCTGTGCGACGGCAACTGAACCAATATCTGCCTGAACGTGATC
GTGTGAAGGTGCACTTTGATGAGGCAGATCGCGCTGATGTTATCTTACAGGCTGGTGTGACTACCGCTCAAGTTGATTATACCAATCTCTATCGCTTGAA
GTTGGAGAGACCCCAAGAGGTAGCCATGGTGGCGCTACCAGCTCGAGTGAGTAGTTTGGAGCTCTGGCATTCGAGATTGGGGCACCCTGGCAAGAACGCG
TTTAATGCGCTGTTCAGCCATGATGAGTGGCCGTTGCCATATGTGAACTTGCGTATCCCGGTGGGTTTCAATTGCGAGACCTGTGTGACGGGGAAACTTA
CGAGGAAGAGCATGAATAAGTCTCGGACACAGACCCGCGAGTGGTTAGTTGGCGAAAAGGTCCATGTGGACGCTTGGGGTCCACTCCTACGGTGGTAAAC
GGTACTTTGCCGTGTTCGTTGATGATGCGAGTCGGTTTGTCACCGTGTATCTTCTGGAGCATCGTTCGGAAGTGTACCAAAAGTTTGAGGAGTACTATCA
ACGCGTCAAGACGCAGCAGCATGTCAGAATGAAAGCGCTAAGGTCAGACAATGCAAAGGAGTTCAAGAAGCTGCAAAGTACGTGTGACACGAAGTATGGT
ATGGAGTTTGACAGCAGCATCAAGCATACTCCGGAGCAAAATGGTGTCGCGGAGAGAATGGTCCGCACCATTACGGAGAGAATGCGATGCATGCTCGTGC
ACTTCGACCTGCCTGAAGCGGTGTGGGGTGAGGCAGCGATGACAGCTGCATACTCCGTGAACATTATGCCAAGCTCGGTTCGAGGCATGGAGGTACCGTA
TGCAGTATGCACCGTCAGACTCCTGCTTATGAGAAGTTGCGGACGTTTGGCTGCGCCGTCCTGTCGTACATCGACAAGGTGGAGAGACGGAAGATGCAGG
CGAAAGCACGGGAGGCGGTCTTCGTTGGATATTCGCGAGAGAAGCGAGGCTATCGCTTGCTCGATAGCAAGACCAACAAGGCCTTCTACAGCCATACTGT
CGTGTTCTATGAGAATAAAGCTGGTCGATTGCTCATGGACTCGGCATCAACGCCAAGTGGAGCCTCCGGTAAGGAATATTTAGGCGTTGATCGATCAGTA
GAGGATGACATTGAGCCAATGCTGGATGAAATGCATGATGACTCAAATGATGGAGGTAGTTATCGTGATGATGGAGATTGCTGGACTGGTGGGGCCAGCG