Description :
From Genome Similarity Track
Location :
contig_13:615831- 617424
Transcript NameFunction/comments
g2475.t1hypothetical protein PHYSODRAFT_555600

Sequence
1593 bases(100 bases per row)
TGGACGCGGATGGAGCTGTGCGTCATCGCCAGTCTGCAGCTCGTGCTGGTGCTCGTGGCCTACCGCTTGGACCGCTCGCAGCACCCCGTGCTCATCTCGG
AGTCCGCCGTTGCCATCCTCTTCGGCGTATTGGTGAGATGTACATGCGACAAAAGACAGATTAAAAGGTCCGGACTGACCATTGATGGGGTTTCTGTTGT
GTAGTTTGGAGTCGGTGTGCTGGTCTTCTACCCTATGGTATGTCGACGGCGATTCGAAGACTCTGTCCGGTGGGTCGTAGACTAATACGACTATTGCTGT
AGGAATCGCTGAACAACGGCATGGACCCCGAAGTGCTCTTCTACGCGTACGTTTCGCAGACTCAATCGGTGAATTTTGGGAAAGCGTCCAAACTGACAGA
TTTTGATATTCTGCAGACTGCTACCACCGATTATCCTGGAAGCTGGGTTCAACATGAAAAAGAGGGTATGCATGAAGTTAGATAGAGTTTGGTGGAACAG
ATTGGTAGCTCACCGCGATGTGCGACTTTTGTGTTATTTTGCTGTCTGATAAACGTCAGGGATTCTTCTCCAACTTCAATGCGATTATGCTGCTGGCTAT
CGTTGGAACGCTGGTTGCGACGTTCATTACGGGCGGTGTGCTGATTTGGCTGGGAGATATGGGGCTGATCACTAAATTGACGGCGGCGGAAGCGTACCTT
TATGGAGCTCTGATTTCGGCGGTGGATCCGGTGGCTACGTTATCAGTGTTCAAGAAGAATGGTGTGCCGCCTCTGCTATTTAACCTCGTGTTTGGTGAAA
GCATGCTGAACGACGGCGTTGGTAAGATATCACATTTAGGTCTTACTGGAGAACTTGCCTTGTGTTTACTAAATTGTTGCTGGTGTTGTGCTGCAGCCAT
CGTGTCTTTTACACTGTTCCAGGGCCTTATTCGAAATGGCATTACTGACGTCACGTTGAACGATGCGGGCATTATTATCATCAAGGTGTTTGGCATCGGC
TTTGGTTCGGTGGGTCTGGCTGCAGTTGTGTGCTTTACGTCGGCTTTTTTGCTCAAGCAAGCTGACCCAGTCCTTCAACAGTACCCCTCCTACGAGATTT
CTATCGTGCTGCTGTCGGCGTACTTGAGTTACGTGATTGCCGATCTCGTTGGAATGAGTGGTATCGTAGCGCTCTTCTTCTCGGGTGTCTTAATGAGCCA
CTACCACCTGTACAACATCGCTGATGAGAGCGCGACGGCGTTGAGGCATCTTTTGACCACGTCTTCTTTCATGGCAGAGAACTTCGTGTTCATTTACATG
GGTATGAGCGTGGTTGCGTACTCAGGATATTTCACGTGGGATTGGGGATTTATTCTCGCGAACATGGTCGCTTGTATTTTGGGGCGCATGCTGAACGTGT
TCCCAATGTGCATGCTTGCGAATCTCTGCCGAGCGGAAGACAGCAAGATCCCGTGGAGTCATATGGTGGTTGTCTGGTTTGCTGGGCTTCGTGGTGCGAT
CGCGTTCGCACTGGCACTCAACGTGTATACGCCCAACCGCATCCACGCAAGTGTGATTCAAAGCACGACACTTTTCACCGTCATGTTCACTAC