Description :
From Genome Similarity Track
Location :
Scaffold_158:61578- 64053
Transcript NameFunction/comments
Physo_143919reverse transcriptase

Sequence
2475 bases(100 bases per row)
ACACTGGAGATCACGAAGTGCACCAAGGGAGAGGACGAGATATTGGGGGCGATCGCCGCTAGTATTACGCCTCGATCGGATATGGACGACGCGTTGATCG
CGATCGCGCCGAAGAAAGAACCCCGGCGGAAGATTCAAGCACCGATCCCGACTGTACGTGCGGACGAAGAGCACCTGGTGATAAGTTTCGATGGATCCGC
CCGCGTCAAGCGAGGCGGGGGCGCGTACAGCGCGATCTTGTGGAAGTTACCCGAATGGAGTGTGGTGAAGGCACGATCGGGGTATGCTGAAGGGTTGACT
ATTAACGAGGCGGAGTATCATGGTCTGTTGTTGGGTTTCGACCTCCTTGACGGCGTAGATCGAGGCCGGTTGGTGGTCTGCGGTGATTCCAACCTGGTGA
TCCGGCAAGTACGGGGCGAAATCGACTGCAAAGCACCTAAGCTGACATTGTTGAAGCAGAAGGTGCTGGACCAACTACGGAACTGGCCATATCACGAGCT
GTTACATGTGAAACGAGACTGGAACGGGAGTGCAGACAGCCTGGCCAGTGCAGCACTCCAACGTGAAGGGGTCGTCGTCGTCGAGGATGAGGTCGATCAT
GAGGATCTAGTGACACTGAACCGACTTGATGAGATCCTGGTTATTCGATCGGATGAGTCGATCGCCCGACTATCACCGATGACCACCCGATCGGGCGCCA
GATCACGGTCGAACCCGACCGTCATGCAGGAGGAGTTCGTGCGAGGGTTGCGGATCGACCGAATTCGTCGAGCTCAAGATGAAGAAACGTGGATCGCGGG
TATGAAGAAGTACCTGATGGGAGATGTGGCTGCACTGACGCAGGATGAGGCTCGATCCTTTGGCAACCTCGCAGCGGATTATGAGATCGACGGTGATAAT
CTGCCGTTCTATTGCCCACCCTCCAAACGATCGGAGGCAGATCGAGATGGGCTGATGAGGCTGGTTGCACCAGAGACGCTGCATCAAGATATCTTGCATC
ACTATCTCTCCACTCTGGAAGGTGGACACCAAGGGATCGGGCGTACATACCAGCGGATCCGCGATCACTTTCACTGGAGAGGTCTCTTCAGAAGTGTGCA
GAAGTACGTCGGCGAATGTGCCGACTGCGAGACCGGCAAAGGACGACCCACGATCAGGGGCGAGCCGCCGGGAAACATCCAGGCGACATACCCGTTCCAG
ATCATAGCGATGGATCACATACCTTCGCTACCCAAGTCGTACAAGGGTAATACGGAAATGTTGATCTGGGTCGATCTGTTCACGGGATACGTGATCGCGA
AGGCGAGCTCGTCCCGAACGGCGCAGACGATCGCCAAGTCTTATGAAGAGTGCGTGTTCCGGCGATTTGGTGCTAGCGAGGTGAGCAGGCATGATCGCGA
ACCGGGATTTATGGCCGACTTCTTCCGCGCCTTTAACAAGATTCTGGGTATGCGTTAGCGAGCGACGATGGCATATCGACCTCAAGCTAACGATACTGCA
GAGCGAATGGTACAGACGGCGACGAGAGCCCTGAAGATGTTCGTGGAGGATCTGGATCAGAGAGATTGGGATGACTACGCAGAGCGATTGACCTTCGCGA
TCAACACGGCTCAAGATCGAGTAGGTGGAGACTCCCCTTTTTATCTGGTGCATGGTTGGGATCTTCGATCGACGCTCGAGGCGACGATACCTTTGGGTAG
TACTCGTACTCGGGATCGGAATCCTCTACGGTGGCGTTATCGGATCCAGAGGCACTACGATCAGGCTCGAAGTCAGGTGAATGCTCGCCTACACGAGGCG
ATCGCGGATCGGGCCGATCGACACAATGAAGAAGTTCGACCACACTCGATCGAGGCTGGATTTCAGGTGTGGCTGTACCTGGATCGAGTGAAAGAGGGGT
ATGCCCGGAAGTTGGTCCACCTGTGGCACGGCCCGTTCCGTGTTGCGGAGAAGGTGAACGAGTATACGATGAAGCTTCAGATCGCTGGTACGGACTATCA
CCTGTTCCCGATCGTGCATGTTTCGAAGCTGAAGTTGGTCAGGGACTTCCCCGATCGACCGCAGATCGCGCTCACGGTGGACGAAGCAGATCGACTTGAT
TTCGACGAAGTCTTACTTCCGGAGGATAGCTGGGCCCCAGATCGAGACGCGAATGAGTACGAAGTAGAGGAGATCACGGATATGCGGACGGGTCGAAGGA
CACGGTACGGCCGGACTTATCGAGAATTCCTGGTACGCTGGAAGGGTTACGACGAGCCTGACTGGGTCGACGAAGCTGATCTCAACTGCGGAGCGTTATT
GTACGAGTTCCTTCGAGATCGCGTGTACCGGAACCGATTCAGCGCGATGCAGTCTCACGAGGAGGAGTGAGATCGGGCCACCAGGGTGAGCGGGTCACCT
TGGTGAGCGAGAGGGATGACGGATCGACGGGGAGGCCGTTGATCGGAGGAGGGGTTGTATATGAATGAATGTGTG