Description :
From Genome Similarity Track
Location :
Scaffold_35:61574- 62578
Sequence
1004 bases(100 bases per row)
TTTGTAACAGATCACTTCCTATAGCAAAGTCAGATGCGTCACAGACGACATTGAAAGGCCGATCAGGATCGGGCAAAGCTAGTATTGGCGCATGAAGGAG
ACTTTCCTTAACTGTTTGAAAAGTATCATGTTCGGTGTTACCCCAACACCAATCCACATCCTTCTTAAGGAGATTGGATAATGGCCGAGCCATATCTGCG
TAATTCGCACTATACTTATGCAAGTAATCGTCAAGGCCAAGCCACTTACGTAGATCTTTTTGGTTCTTTGGAACAGGCCAATCAACTATGGCCCTTACCT
TAGCGGGGTCCGCTCGAAGGCCTCGCTTCCAATGAAGCACCTCAGAAACGGAATCTCTTCTGCACCAAAGATGCACTCAGATGCATTTGCATACAATTTA
TTCGTGCGCATGCACTCGATCACCGCTCGTAAATGATCAATGTGATTATCCACATCAGATCGCCCGTTCGTTGCACGAATATGGACAAAGATGTCATCAA
AGTACGTTTGTGCATAGCCTCGGTGAGATCTGAATAGTTGCGCCACCAGACGATTAAAAGTAGCCGGGGTATTTGACAGCCCTTGTGGCATAACGAGCCA
TTCCCAGAGCATACCGCTTGGGGTACTAACCGCTGTTAGCGGAATATCGCTTGCTCGCATGAGCAGCTGGTAATAACCATCGACTAAGTCGAGCGCACTG
TACAATGTATATCCCACCATATTGTTCTGAAGAATATCCTTTCTGGGGATTGGCGTCTGAGCCGGGATTGTGGCAGCATTGAGCTCATTATAAGCGTGCA
CAATACGCCACTTACCATTAGGCTTTTTGACACAAAATATAGGTGTGAAATGGGGAGACTTACTCTCCCGCACCATTCCCGCCGCGTCTTAGCACGAAAG
AAATCGTCAATGACGTCACACTGTTCCTTAGATAAAGGCCACTGCCGTGTTACGCAGTATTTAGTTCCTGGAACTAGGTCAATTTCATGACGTACACCTC
TATC