Description :
From Genome Similarity Track
Location :
contig_125:61568- 68296
Transcript NameFunction/comments
g14051.t1POM59587.1 Ribonuclease [Phytophthora palmivora var. palmivora
g14052.t1hypothetical protein

Sequence
6728 bases(100 bases per row)
GGCGCGGGCGTCCACATATGTGAACGTTGCGAGTACCGTGTTGTCTGCAGGCGGCATCAGCAAGACGGGCAGGGGAGCAGCACTTTACGCAATTGAGGTG
CCCGGGGGCTACTCAGAGATGCAAATGCTGCATGACCGTCCCAAGGCTGTGTGGGATCCCTACACTTCCCAGGAAAGCGGCTTGACGGAAACACAATGCA
GATACGGCTGCTCCTTCGTCGAGAATTGTTCAATTTTCTAGTGTGAATATCTACGTGAAGACGTGTATGCAACGCAACTCGACACTACGGTGATCCTGAA
CAGTGAAATTACCGGCGAAGTTTGCTCTTGTGTTGAAGCACAGAGCTCTGAGAAGCATCGGTCAGAGGACCGGTCTCCATCGGTTCGAGCGATCGCCAGC
AAGGTTAATGCTGAATTTTCGTTGATCAAATCAAGCTCGTCGATACTTCTCCAGCTAGAAAATCGTAAAGTGTCTGCACTTGAAGATGTATGTGAAGACG
TGGCTGACCATTTGCTGATAACACAAAATCGACTGGATGAAGTTTCGCTTACGAGTCCAAGTGCCGCCCAAGCGTAATACGCCCGAATCGTGAAGCACTA
CCGTGCAGCTTTGGAGACCGAGCCACTGTTGAATTGGGATATTGGGCTGGAGGACGTGAGCTGGGAGTATAGTTGGGATAATATGATCCGGCACGTACTT
GGGCGGGAGTTACCCAGTGCAGAATCTCAACAACATGCCTTAACTTTGCTGGAAAACGAAGCCAGACAAAGTTGAAGCGCCAGTATCAAGCTCACGAGAG
ATTGGTATTTCTTATGGTACGACATTAGAAATGAGTTTTCCTGGAGAAAAAGAGATCCCCGCTGGACTGGCAGCTCAACGATTAAAGGGTTAATATCACA
AGCAGCGTTGCACGCTCTCGAATGCAACCGACCAACTCGCAACAATTTGCTGGTAGTGAGGTGAAAGTCGAGCGTTGACGGTGACACACCGCTACCGAGC
CGAACGCCTCCATGAGCTCAATTGAGGTGCTGAAGTGGTATCGTGACCAGTTCGTTGACGAATCCAGTTGTGACGGAGCAGAGAGTGCAAACTCCATCTT
TTGTTCGTGCGACCGACTTTTACAAGACAAAGTGAACTGGTACAGTATGCCTGACTTGCAAGCGCAAAGGATACAGACAATCCTCTCCTTTGTGATAGCG
TCGGGAACCACCACATTATCACTCGCTGGAGTTATTACAAGGCAGAAATGTGCCGTAAAATTGGTACATTTGAACTTAACAGCTCTACAGCGTCGACGTA
CAGCAGGCAGTACTGTGGAGCATCGAGAGCTGGAATGCCCTGCTTCCCAGCGTCTTCAGTAACTGCTGGAAGAAGACTGGCTTGCTTGACTACTACACGT
GCGAGTACGCCGAGCCGGGCGTGGAGGATGACATCGTGAACGAGCTGGCAGAGATGCTGACGCGTCTCCACCCCTCGAATCCGATGTCGGTTGAAGAGCT
GCTGAACCCACCGGACGAGAACATCCTCGCGGATGAACCAACGGACGAAGATTTCTGCCGGGTCGAGTCTTCAGAGCGCGAGAATGGGTGCGGTCAAGAT
GTCGGTGATGGCGGTATCGAGGACGAAGAAGAAGAAAGCACTTCTTCAACCTATCCAACGCCCGAAAACCTGTCCACAGAGGAGCTGAAGGAGCGTCTTC
AATGGATAGCACAACTTTTCGTTACCGCCGGTGCGATGGGGGTCCGTTCAAGGGACGTTATCGGGCTTCGAACGATGCAGCGAGTATTTAGAGAGGAGCT
TGCGTGTAGACAAGGCCACAAGCAGCAAAAGTCGATGCTCGACTTCTTCGGACGTCCTGCACCAAATGGACCTTAGCAATAGTTAAGCACCTTTGAATAG
TGATAATGACGTGTTTTGTATCACAAACCAGTAACTAGAGGGTAGAGGTATATTTGACTCGTGCTTGTATGGTGACGGTCATCGGGAGCCCTCCCCATAT
CTCTCCGTGGAGGGTATCACTACTCAGGATATCACGACCGAGAGGATTGTCTGTACCTCGAAAAAAACGCGACCGACGTTGTGACGTTGCAGGGTATTGC
TGAGGTCCTTCGTCGACGGTCGAACTGCAAACCGTGCCGACAGCTTCTGACTTGATTATAATATTACTTAGGTTGTTTGAAGAGTATTAGTACTGGACCA
CTATGTACCCACAATCAATATATTCATTGACAGAGGTGCAAACCGGACTTGCTTTTGTCACGGGCTCTGTTACGCCCTTCAACGAGTTGTCGTGCATGTC
ACTCGCTAGGGTTACCGTAATGCCAGTCGCGATGACCACGAAGCAAAGGTTGAGACCTGTAGACGGCGATCCTATGTCCCGCGTGCTCTCTACGCACGTC
ACATTTGTATGGCCCTCGTCAAAGGTGCTCGACTTCGGTCTCACTTCCCAATTTGCTCAGATTCGTCCACAGCAGATCCCCACGGGCTCCTGGTACCCCG
TCAAGCATGTACTCGGTTGCTCTGCTCCTCGCTGTCTCGTCGACGCTTTCTGCACAGACGCTCGCCACTGACTACGCTGGCGGCTGGATCAACGGCTCCG
CGTCTTCGGGCGAGTGCGTGGATATCTGCTCGGCCCCGAGCGCCACGTGTCTGACCAAGGACCCGACGTGTCTGGCCAAGCAAAAAGTGCCCGGGGACTT
TGACTACCTCGTGCTGGAGCAGCTCTTCGTGCCGCAATTCTGCCGTGACCTGCTGGTCGGCGTGGACGGCACCATCTCGCATCAGAACGTCAACCCGTAC
CCGAATGGCACGGCCTGCGTGTCCGAGCGTGCGGTGAGTGAGCTCACGATCCACGGCCTGTGGCCCAACTACGACGACGGCTACGTGAGCTGCTGCAACC
CGAGCGATTCGGTGGCGAATGATCCGTACGACGCTGACAAGTTCGCGGCGAACCAGGCGGAGCTGCTGACTCAGATGGGCGACAAGTGGATCGACGCCAC
GCAGGACTCGACCCACGACACACTGTGCGAGATCTACGACCACGAGTTCCAGAAGCACGGACTCTGCTACGCCGCCCAGGGCGCCGACCTTGAGGCGGCC
GCCGTCACGTACTTTGAGGCGACCATGAACACTGCAGACCGTCTGAGCGCTGCGACCCAGCAGATCAACGCGTGGGCGGCGCTCGACACGCCGCAGACGA
CCTTGGCTGAGATCGAGGCGCTCTACGACCACCACGTGATGGTCTTCTGCTCTGCTGTGGACGGTGAGAACCAGCTTTCGGTCCTCCGCACGTGCTACGA
GAAGCCCTCGGACATCGGCAGTGAAGGCCCCACGACGCAAATTGACTGCGCCAACGCGACGGCCACGTCCACCTTCTCCGTATGCTCTGGCGACGAGCCG
ATCACGCTCCTGCCGTACGTGGCCCCGGGATCGGCCAGCACCTCGGCTAGTGCTGCATCAGCTACTGCCGAGCCCACCTCGGCACCAACTCCGGCTGCCA
CGTCAGAGCCTACAGTTGGCCCCACCGCCAACGCATGCATCTAGAGCGTCCAATAGACTGGAAGCAAAGCATAGCATACCGGAATAAAGCTACACCCCAT
TGCTTCATATTCAAACAACTTGCTTGCATCCTCCTTCTTGCACGCAGCTTACACTTCAGAAACCATTCAGAGTCAGGTGGACGTGTCCAATTGAGTCTCC
AGCGCGTTGAGTTCATCTTCAAATCCCCTCAAAGCAAACCCCGCAGTCTCCCGTTGACTCGTATACTCCCCCAAGAACTCCTGGAACCGAGCATCAACGT
CGCTCAAACGCGTCACAGCTTCCACCGGTGCGGCGTCTCCCAGCTTCTCCACCTGGAACTGCGCTCGGAGGATCCGTTCCAGCACCGCTTCTGCCCCGTC
TTGGACGTCCTGCTCTTCCATCCCTTCACACAGGTCCACAATGTCGCTCAACTGACTCGTGACAGTCGGGGGGCCATCAGCCCCGTCGAACAGCTCCAGG
GTACCCTCTTTTGTCGGATAAGTCTCCACCGCCTCGGGTTCTTCTCGCTCGAGCTGTGTCCTTTCCTCTTCACTCGACGGCCTCACCGTCATGCGCGTAG
GCTCGGAATTCTGCTTCTCTGTCGACTCCTGGTCATCTTGGAGCGTCACCAATCGACAGCCCATTGCCACGTGAGAATGATTGAAGCGGGGACGTGCACA
GGTCGGTCGGTACCCCGAAGCGCTGTTAAAAAAACTAAGGGAAAAGGATACTTGTCACAATAGCCAAAATGGGACTCCCCACCGATTGCCTCTATGAAGC
TACCATCCCAGATCCAAATACTTCCACACGTTGCTAAGCTCGTGAACGACCTCCCTGCGACCATCGCCACTGCTTCTTACAACGAGATATATATTGCCGC
CCCGTGATAGTTGAAGCTGTGGACGGCGATGCAGCCCAGGGACGTCTCGATAACATGCAGTGGCAGTCGAAGTGAAGCTTCTTCATCAGCTGCATTGATT
GGAGCAGCTTGAGAACAACCACCTTCAAGTGCTCTAGTGACCCCATCGCTATCACGAAAGTCGTAACAGGCCCGTGAAAGAGCTTAAATGGACCGCGGAG
CATCGTCGTATGCGCTTTTACGATCCAGAATGGCGAGAAGAAGTGGGTCCAGCAATGGTGGGAAATGGTGATACCAGGTTCGCTTCTTTTGGGCAAACTG
TGTGCTGCAGCAGCAACAAATGACCACATGCAAGTGATCTAGCTACTGCTCGAGAGACGTGCCTTCATTTTGGCTATATCGTGCTGCAAATATGATGGAG
ATGATTTTTTATTGGGAGGTGTAACAAAAGATGTGAACCTCTCACTGCAGTATGCAGCGGGTCCTGGTCAGATTGATGCAGTGCTTCTCCCCAACAGGGA
TTCGGATGGCCAGGTCATACCAGCCTCTCATGGACAAAAACAATGTGGCAAGCACCGTTGAAGCAGCTTCAATGGGAACTCGTGTGCTCACACCAGTCGT
GCCCTCTTGCCGTCCAATAGCTGCGCCACATCATCGCAGCCAACTGCTCTCGCTCGTGCCGCTGCAGCTCAGATACTTTTTTGTATCACACCGGTCTTGC
AGCAATTGTACAACAGTCAGTCGGCAGTCCATCACTGTTGCTTCCAGGGCGTACGCGGTAGCAACGCATCGCCCTTATCCAGCAGCAACTTCACCACTTC
TGTGTTGCCTTTTGCAGCAGCGGTAACTATCCCGCGATTGATAGCGCATCCACTTGTATCTTCGAGCAGCAATCGCACCATGTGCACCAAATTGTTTTCC
GAAGCATGCTTGGAAATGCCATGTACGTTCCGGGACTGCACAGCTTAGACACTTCAATGTTACCAGCTGAGGCCACTCTCGTGAAAGCTCGATTAACGGT
GTCTGGATCGCAGTGGTCAAGCAAATATTTCACGACCCCCACTCGATCGCGCCATGCAGCACAGACCAACGCATTGCCTTTAGAAAGTGATCTGCTGAGG
TCTATGAACATTTTCACAACTTCGAGATGGCCGCTCTCCGCTACGATTTCAAGCGCCCGGCCTGCCTCAAATGCCTGCACTTTGCTGACAAGGAGGTTTG
CCATTTCAACATCTCCTTTCGTCGCAGTATATTCCGCAGCTGATGTGGTAGCTGCCACAACATCCAAACGAGACAATCGGCTCTTTGTAGTGTAAGAGCT
CAGCACCATCTTTGCGACTTCCCACTGTTTGCTGGATGCTGCTACTTGGAACGCATGAGCAGCCTCAGCGTTACTCCAGTCGAGCAAAATCTGTACCAGG
TTCATGCGTCCAGATCTCACAGCGTCCGAAAGCAATGCCAAAAACTCCCCAATGAGCGGGTTGTCCATGATTGACTCAAAATTGCAATCGCTCGGCGACA
CATTGAAACGAGGAAACTGCCCCAAGAAATATTCGACCAAGGCACAGTGATCGTATTTGGCTGCTTCCCCCAGTGCAGCTGCAAACGCGTGCTTGCCAAA
TATGCCTACTTCTAGCATCCGAGTGGCCACGTTCCAATTACCTTTCTGGGCAGCAGCCTGGAGTGCTTCTTCATTTGCAAAGGGATCACATAGTCCAACC
AGCATCTCCGTCACCTCTGTTTGATCGTTTTGCACAGCCGCTTTTAAAGCACAATTCACCCCGAATAATCTTTGTCCACTAAACCTCTCGAGCAGATACT
GTATCGGCTCTACTTGTCCATTGGTTGCTGCAGCGACAAGGGCCTTCTCCACATCGAACACCCTGGGCAGTAGAATAGCCACCACATTTACATGTCCGTT
TGCAGCAGCAGCTCCCTCAATCTCACCGGAACCAAAACCTGATTGTTGAAACTCCACGACTTGAACGTGGCCATTTCTTGCGGCCGCGGTGATCTGCTCC
ATGGTTCTCTCGAACTCTGGGTAATGGCGATAGAGCCACCGCAAAACAGCAGCATGTCCATTAGCTGCAGATGCCATGAAAGCTGCGAGCGAGCAGCCTT
CGATCCGACTCGTGTGAAGACGTCGACAAACTGCTGATTTCCCTCTGGTGGCACCACCATCCATGGCTCCAACTGTCACTGCGAGAATATCGGAATATCT
GCTGAGAACTCCACGCAGTTCCAGGTACACGGCGGCGTCAATGGTGGAAGGGATTAAGAAGTCACTCACGATCTGCTCGACGTGCAAAATGACACTGGTA
GCGCCAACTGGACAGTGTGGAGCGACGA