Description :
From Genome Similarity Track
Location :
Scaffold_53:61552- 63654
Transcript NameFunction/comments
Phymu_g2834hypothetical protein PHYSODRAFT_286381

Sequence
2102 bases(100 bases per row)
GAGGAAATCTTCAGAAGTGCATGGACGTTGGTGCGAGCCCAAAATACCCTCTGTTCTGGGCTCCTTAGATGCTGTGCTACCAGCCAGGATCAATTCAGCG
TAGGAGGCGCAGGATTCAGTGCTCTCAGGAAACACTGCCGCGAGAATGTCCGTGCCTTCGCCGCGGTGACAGTGTCGTCCATTCCAGTCGTCGTGGTGCC
GGGTattgaagctgtcgtccTGCTCATAAAAACAACATCGAAGAGCTCCCGAAGATACCGGCGTCATAGGTGACTTGATCTTTGTATACTGCATAGACTA
GCCAACATCGGAATTCGCCCAAAAGTGTAGATATGACGCGCCCGAAATAATCGAAGAAGCCCCGTCGCTGTGCAGTTTCCCCATCTCCACAATCGGCTTT
GACGCACAGTCGGCtgtggcaaattgccactggcaaTCTGAAGCTTCATCATGAAGTTCATGGCGGAGCTCGCCCGCGGTAAGGCCCTTGTTCAGGTGGA
AGGCTCATCGTCGCCACTGGCCAGTGGTCGCTCCGCCGTGGAGACAACTAACGATTATGAGCCCAAGTCGACCTCCGCGACATGCTCTGCGAGAAAATCG
CCACTACTGGGCCTCTTCACAGTCCGAACTTCACCTCTTGAAGGCTTTCTATCTTCAACCCGCGTGCGGGCATCATCGCTCGCCATCCCCGTTGCGCTCG
ATACGGCAACAACCCAAAAGTCAGGCAGTTTGATTGCATGTGTAACTCCACAGAGTTTAGCCAGCGGAGACGTTGCCAGCGATCGTTGCAGGTCAGCTTG
TCCGTCCTATAGCCTTTTTCTAAGAATCCCCTCATACATATATTCGCCAACGGGCCAGCCGCTGGTCAGTGGCCAGTACACTTCGGCCCGCCGGACCTCA
GCACGTGGCGGTAACTATCTTCTACGACAGAGTGCTGCTGTCTGCGCGGAAAGCGATGGTGGCAGGCCGCCACTGACGGCGAGCGGACAGCGCAGTTTGA
CAACAGATCACCGGTGATCTGCTCAGCGCACTCAACTCTTGCGATAAGTACGAATGGCGGTAGGTCCCAGAGCCGGGCCCCAAAGGGACTGTTTACTGAC
CAGAGAGCATCTACCGCCATTGATAGGACGTGCCGACCTCCAACGTGGTTGCAtcaaagctcgagcttgaacgGATCGCCAGCGCTGTCATTCTCGAATT
CGCCTCACATCGAGCGAGCAAGTCCACAAGCGACAGAGCGAAGCCTCCAAGCCCACGCGTCTGCAAGCAATTCGTCACCTTTGCAGTGTCCTGTTCGTAT
CTAGTCTGTTTCGTCATGCACATGCTTGCCACCGGATCAAGTTCGCCAATATCGGCCACCAAGCCTAAGCCCAAGCCGATTTCGCCAACGTCCAAGGGCA
TTTGGTCGCAGGAGGAGCATGACCGCTTTCTGGAGGCCATGAAGCTGTACCCAAAGGGACCGTGGAAGACCATCGCTGACCATATCGCCACGCGCTCTGT
GCGGCAAGTGCAGACCCACGCGCAGAAGTATCAGGAGAAAGTGTCGCGGAGACTACGCGGCTTACGCAAATCGAAAAAGAAACTAGTGCGCCCTGAGCAC
CGTATCGATGATGACacgatggagctgtgcaAGTTGGTGGACTGCGCCGCCGAGAAGTTGGTCGCTGCAAGTAGGAAGTCGTCTTTGCGAGCCAATGGTG
TCAAACTAGAGCCGTTGCAAAAGAAGAACATCGTGAAACTGGAGCCTGTTGAGGCTCACAGCAGCCCGCGCGGCACGGatgtggagatgaagaccGACGA
tttcttgccgttgccgttcttgGACTTTGGGGATGACATCGACTTGGACCCAGTCCACATCCCCACCGTGAGCGAGTCATTAGACTTCCTAATCGACTAC
CTGTCGATATAattcctgcagctctggtGCTGTTAGTGCAGTATCGACGGGATATACCCGTCAGTTTTGGCGAGGTATCCGTGGTCAAGCGCACTTCTAA
TGCGATTAGCTTCATATATTTATAACAAAGAGCCCTTGCAATTGAACCTTTTGTCGGTAGAGGCCTCTGCATTatgaagcagctcgcacaGACAGCCACA
AA