Description :
From Genome Similarity Track
Location :
Scaffold_83:61535- 62694
Transcript NameFunction/comments
Phyke_g3544lipid exporter ABCA1 family

Sequence
1159 bases(100 bases per row)
CGCAGGACTCTACTTCGAGCGTGTCATCCCGCGCGAGTATGGCACTGTCGAGAAATGGTACTTCCCAGTACAACCAAGCTTTTGGATTCGCACCGCACGC
GCTAAAAAACACTCCAGCAAAGTTAACGACGTGGCCAGTACTGATGTTCATTCAGTTGATGTCGAGAATGCCAACATCGAGCCTGTCACGGATGAATTac
gacagcaagaacagACGGGTGAGGCATTAGTGGTTCATAATATCAAGAAGGAATTTCCCGTGCCTGGAGGAACCAAGCTCGCCGTTCGTGGTGTGAGCCT
AGCCATGTATAAGGACCAGATCACATGCTTGCTAGGTCACAATGGTGCAGGCAAAACCACTCTCATCTCAATGCTCACCGGGATGATAGCGCCTTCGTCG
GGTGATGCATCATTCCGCGGACTATCGCTCGTGCATGACATGGGTGAGATTCGGCAATCCCTGGGACTCTGTTTCCAGCACGACGTACTCTACAGTGAGC
TTACGGTGGAAGAACATCTAGTTTTCTACGGTCGAGTTAAGGGCTATCACGGGGCAACATTACGCGAGGAAGTGAACACCAAAGTGAAGGAAGTTGGCCT
CACCGAGAAGCGACACGTTTTCGCCGGCGCGCTATCTGGCGGGATGAAGCGAAAGCTATCGGTTGCCATCTGCCTACTGGGTGACAGCTCGCTGGTGTTT
TTGGACGAGCCCACTAGTGGTATGGATCCCTACAGCCGACGCAGCACCTGGGAGATTTTACTCAACAACCGTGCTAACCGCGTCATGGTTCTCACGACAC
ATTTCATGGACGAGGCCGACATATTGGGGGATCGTATTGCAATTATGGCTGAGGGTCAATTGCGCTGCTGTGGTTCATCGCTCTTCCTAAAAAATCGCTA
CGGCGCTGGATACAACTTTACATTAGTCAAGAGCAGTGATCCGGCCGCCCCTTGCAAGGAAGCGCAGCTTCAGACATTTGTAAAGGCACGTGTGCCTACA
GCTAATGTGCTCAGCAACGTCGGTGCTGAGATCGCCTTTCAATTGCCATTGGACTCCACTGCTTCTTTTCCACAGCTCTTCGAGGAGCTAGACGAGAAAA
TGGGCGAGTTTGGCGTGCTGTCCTACGGCATTTCAGTGACAACGCTGGAAGAGGTTTTC