Description :
From Genome Similarity Track
Location :
Scaffold_33:61525- 67417
Transcript NameFunction/comments
Hyaar_Emoy2804912avirulence protein ATR13
Hyaar_Emoy2804913hypothetical protein
Hyaar_Emoy2804914hypothetical protein

Sequence
5892 bases(100 bases per row)
AAGATCAAACCAAATTAAGGGTGGTTTAGGGGAAGAGAAGTTTGTGATATTCTGCCCCATTTGCATCATTGTTCGCGTAGCCTTTCAGTACGATCTTTTT
AAACTTATTTTTGCGTAACGAGTTTTTGATCAGCGTATACTCATCAAAGGCATGCTCTTTGGGAAAATACCGGTTAGCTTCGCGAACCAAAGCACAAAAG
TCTTTATACTCAGTGCTGCCCATGAACGACTCAGTCTTCTCCTTGCTGCTCTTCTTCCATTGATTCAGCACTGCCCTCAAGTGATTGCGATACGCCTTCC
GCGCGTGAACCGCAAGATCTGCATAGTTTTCTCCGTTGTTCGTTTTTGTGGTCTGAACACGAGTTAGAACGTTTTTCACTTCTCGAATAGTTATGTCTGG
GTGGAGTGGTTTCTCAAACAATTCCTTTACAAAATCGATGAGCTTTGTCAAGGAACCTGCTTCTTTGACTGTGGCCGCTGCAGGAACGTGTTGCAGGAAT
CTACGGGCAACGACATTTGTCTCGTCACCTTCGACTGCACGGGCGTAAAGCAGGTTCCCACTTGATACGAAGATGATGACGCCGGGCAGCAGCACTCCGT
AAACGAGACGCATTGCAAGGTAGCCGGACCGAGGAGTGCTCTGTACAATGGAAATGTGAAAATGACAGAAGTACGAGCTCTGGAAGAAGCAGAGTCGGTC
GTCAACAAGCACAGTCCAAACGCTACACTCGACAGGCGGGTCCTGTCGTCCAACGAAGCAGATAGGCGAACACACGTACGTATGCTATAGTATACAGCCT
AGTATGTAGTTAGAGACAAACCTTGGGCGAGTGGTGGCTACCCTTCCTGTATGATCCTGACCAATGTATTTGGCACAAAAACGAGTCGAAGCGAAGCGAT
GGTGGCTTAATGCCTGGGACACCTCCCCTCCCCCCCGTTCCTGTTCATGCCTAGATACCATCTGTAGTACAAAAAGAGGCCGTTGGACTCTTCCAACCCT
TATAAATACATTAACTCCCTTTCAATGGTGGGACATCGAAACGGGACGCGTTAAACATCTCCAACTCATAGACTACCTGTGTCCAACTCTATCTTCAACT
ACACAAATACATCTAATCAGCTATTTTTGAGTTGTGATTTGCTCTCGATTTGACAGATGGCAGATGAGAGCGGTACATAACACCGTATCCTGCGCCAAGT
GAAGCTCCAAGTACGCAATTAATGTTCGACGGCAACCGCGATCATGCTCGCGTCCCCACCCATTTCTATCGTAACAGAACTTGACGAGCCTAATATTGGA
CGTGTCACCGCCGCCAGTACAACATTACTATGAGTGGATGTGGGGTGCTGCAGTTCCTGATAAAGAAATGAACGTCGCTAGTCTGCACGTAGGGTCGCCA
GATGGAATTACCCCTACAAGGAGCGGGACGATCACATAGGCCAAGATCATGCAAATAGTCGAGTGTCTGCGGTTAGCATATAATTGCACCATTCAGATCA
TATATGACAGCCCGTCGTCACGAGATAACTGAGGAGCTGAACGACGGTAATGTGGTCGCTGCTTTTAAAGTTATTTCAAAAGTGTCTTCTGTTCATGAGC
GTACTGTCCCTTTAGCTCTACTAGAAGGTTTCGGATCACCCACAGTGCGAAATCTTTGCCACAAATGTTACTACTGAACGCAAGTAGAGCTCCGTCATCT
CGAGCGCATTGTGGCACAGCCGCAACTTCGATCGACTGTCAGTCGGAAAGTTGCCCGAAAATGGCGCCATGTCATCAAGCACCACGTCAGCCTTGAGTCT
TCTCAGTGCTTCACTCAGCTGTTCCTCACTGTTGTATGGCCAAAATCACCCACGAAAATAGCTATGCCTGCCACGAGATCAAACTGTTTAAGGTTTACAC
CCACAACTGTCGGTAGTGACTCCCGAGTCTCCGCCCTCTGTCACTACTTTTTTTTTGCTCTCAGTGTCGTTTAGCCTAGGGGCGTGTTTCCAAAGGACGT
GGAAAGCCTTTGATTTGATGTCCTAGTATCCCCGATCGACTGCGTGTCGAAGCCACACAGCCAGTTCTGGAGGCCTGGGCGGAGTAGACTTTTATGAGCC
TGGGAATGCTCGCTGCATGAGCGTCCTCCATACATCTTCATTGGCCGCCGTCTCCGAAACTTACCATAGAAATCCTTGGATCATCGGGTGGACGAGAAAC
ACTGAAGTGCGATGATGCGTGCGCTACCAGTATTGACCCTGATCAGGCGAGCTATGTAACTCGGATTGTATAAGATAATGGATGGCAGTGGCACCTTGGC
GGAGCCCCGGCGAAACCCGACAATAAATACAGCCTGTATCCGTGTCCACTGCAATATGTATCGAAATGAGTTTATGATTCCAAACGATAAGACGTAACGT
TTGCCAATGTTGGAGAGTGACGCGGACTGTCCGCAATCATTCTAGAGCACGCGGTCCATTTGTGTTGCTCGCATGGTGCGACGTTATGCACCGCTGTCGA
TTTGCCATCTGTCAGAAGAATTGCAAATCACGACCAAAAAAACTGATTATATGTATTTGTGTAATTGGAGATAGAGTTGGACACAGGTATTCTATCAGTT
GGAGATGTTTAACGCGTCCCCATCGAAACATCATCTTTTAAAAATTCTACCTCCCCTCTCTTGTACCTCTAGTAAACAATTGCACATAATTAGTGCTTTT
GAGTCGTGCTCTGCGATCCCACGCATCACTCAAACACAAAATCATTGTGTCTGTGTGAGAAAATCCTCATGCGTCATGAATACACCTTTACTGATAGAGT
TTAGCGTTTCGATCGTGAAAGCGCTCGGTCACTAGCTTGGTCTCGTGCAAATTACCGCAATGATCAGCTGATACTTCGATCGTCTGTTGTTCTCCACTCG
CCTTGTTCACCTTTCGTAGTACAGCAGCTCAACCGCCCGCATTTGCCACATAATGTGAGTGATCGACGCGATGATGGCGCACGACCCAGCGCTGCAGTAG
CCCTTCGACAATCGGATGTTGGGAGCAATAACTAAGAGCTACTGCTTGAAGTATTCAAGCAATCTTCGTCAGAGCGAGAGAAAGCGCTATCGTCGATTAC
ATGGACTCATCGCTAGAGCTGTCAGAGGTAATGTCAGCAAGCATTTCTCGACAATGTGATGGGCAGAGGTGGATCGCGAAGCGATTTGAAATTTTTAAGT
AAGCTTTATCGCTGGGCACCTAGTTTGCATCCACTTACTCTACTGCTCGTGGAGCAGCCGTGCACGTCGAATACCGCGTTGATTCGAATTCCGCGTTGAT
CCGAATACCAGCATCCGTCGTCCTTACAACGTTCACGTTACGGTCTTCACTCGTTCGGTTGGTCTATACCGAAAAAAATGCTCAGCACAGCAGTAGTTTT
TGTCTCATCAACGGCCATACCATCTTACCTGGTACTCAGATGTACAACGGCTCATTACCACATGAGCTGGAATATCCGTATCAATGCCCGCAATATGTTG
ACGCTTCCTTGCTACTTGTCCGCTGCCAACACCACAGCTATCTGATTTACTAATAAGGCCAACCGTAGACGGCAGTGACGGTCGTAGTTTCACACGCTCA
CGTCCCACAAGCAGCAATACGTCACATGTGCCGAGGTCAAGTTGTTCAATCCATTTGAATTCTACACGACGACAAAACTCACACCCAAGACATCACATCC
CAACCTCAGTAGTGTTTCTCTCGTCTCCAAAGTGATGTCCACGCAACGCTAAACTCTATCAGTAAAGGTGTATACATGACGCATGACGACCTTCTCACGC
AGACAATGATTTTGTGTTTGGGTGATGCGTGGGATCGCAGAGCACGACTCAAAAGCACTATTTATGTGCAATTGTTTACTGAAGGTACAAGAGAGGAGAG
ATGGTATTTCAAATCAGGACGTTCAGATCGTCGTTTCAAGGTTTCTACGCGGTTTTCGGCGCGTTGTCGAGAAAGCAAACGACACGATACTACATTTTTA
CCTAGACCGACTTGACAAATCAATTGTCGACAGGTTCATTTGCCCACTTTTTTTCTCAAATGACTTTTTTTGGTTCAGGTGTCGATCAGGAGAAATACTC
AACCGTATCTAATGAATCTGCACCCAGCATCTAGTGTAGCATCTTGTCCGAATTAGCAGTTATTTCACCTATTTAGTCGTACGTTGCACGTCTACGGGGA
CGACGAATAACCCCTAATTCCAACCGCTGGGTATGAAATGTAAGCACGGCCACCTATCTCCGCTCAGCTGCCAGATCTCCATTCATCAAGTCCGGATAGA
GGTTTTCCACTGAGCGGTTGTGACGAAGATCTAGTTCCGTAATCGTTAATCTACTGTGTCGTAAGGCTTGTTTTGTGCTTGTACGTGTTGATATAACTCC
AACATTCATCCGTTGTTGCTTCTAGATCGACATCTCAATTGATATACGCTGCAGTGATGGACCTGTTACCTCACAAGGCGACCCGTTCAAATGCAATGGG
TCCGAGACGGCAGACGAAAAGTAGACATTCTTTTACGCATGGGTAGCGGTGTAGACGACGATTTAGATGTTTACACAGGGGAGAACAATATGGGTGTTAT
TCTGAAAGAATATGCGATGAAGAATCGGATACCAGAAGGCGACGCAGATGGTACTGGAGACTACATCAAAAATGACGACAATGACAACGACGATGAGACG
GTCACAGGTATTGCTGGGCAATCCTCAGTTGTATTTACTGAGTTTTCGCGAACACCTGACCGAATTTTCAGCTATCGATCGTGAACGTTTCCAACACTAG
AGGCAGGATAATAGTTATTGTTATATGCCTTTCGCTGTACTTCTTCAGCTGTAAATTATATGCTCCCTCTGTTTCGCCTACGTGATAGTTAGTTACGAGC
ACGTAGCAGAGATATTAACGTGGTAGAATGGCTACATTGACGGATTAGCAACAACTACGACATGAAGACACATTAATGGCGACATGTTTGCATTACGATT
GTTCATCATATCTCGCCATCGCACACTAGTCTGAAAACAGCATACAGCCATTCTCAAGTTGGTTTGTTTCGCGTTGACAATACCGACATCCACCGTGTAC
CTTACTCATTCGGACTAACCCTTGCCGCATCCGAATCACCGCGGCTTCTGGCACGGACCCTAACTTTGTACTGCGGGTGATCGTAATTTTTCATGTCGTA
CCACTGGACCATTTATCCGTGAGTCGTGCAATACTCATGGAATGATGCATTCATGTCTACTCCGTACACGATGAAGTGGGTACTGCAAATTGCTTGACGC
CAGGCTGGATATGATAATCAAAACAACGGTATACATGGCCGTCTCTCGTTTGATCGCGTACCTGGCGATCGTCGCTGCATGGCGAAGTTAGGACATTTTC
CAAAACCTTTTTGTGCATCGCTTTGATTGCAGGAAACGTCTCCGAGCTGAACCCTAACATCATTTTTTCCTTTGACCGCGTCTAACAAAGACTAACTTCT
CTAGAATATTCATCGATTGTAAAGATAGGTAAGCACGCTTGTATACCTGTATGCGGCCTCAGAGTGCAGATAGACCGTTTCATCTGAAGTTGTTGAGACT
TCCGTTCCAACCAGCTTTTCATCGTCGAGATGAGGGCAACTTCGGAGGAAACAGCTGACTAATTTGGCGTCGTCCTTCATCTATCGGAAGCGATCTTTTG
CTCTTCACTTTATGCAAGCAACTACTTATTTTCGTTCTACCTACTGGGTAGAGCGTAAATGTTTAGTAGCGGCAGGCCATGGTCAACAGGTGCGCAAATA
TACTGCTAAATAGGTGAAATTACCGCTAAATCGTACTAGATGCTGCACTAGATGCTGGTTCAATTTCAAGAGATGCGGTTGAGCATCTCCCG