Description :
From Genome Similarity Track
Location :
Scaffold_24:61502- 65637
Transcript NameFunction/comments
Pytul_var.sporangiiferummaker-pug3_contig_24-snap-gene-0.40Gene of unknown function
Pytul_var.sporangiiferummaker-pug3_contig_24-fgenesh-gene-0.15SET protein
Pytul_var.sporangiiferummaker-pug3_contig_24-fgenesh-gene-0.27Gene of unknown function

Sequence
4135 bases(100 bases per row)
GGCGGCTCTGGCGAGGACGACGACCTGGATGTCACAACGCACAACGGCGTGTACTATTTTGACTGCAAACAAGGCAGATTCATGCTTTGTGACCAGGAGC
AGAACCAATTTCTCGTCGACCTGAGTGACAGCGCGATGGTACGGACGTTTNNNNNNNNNNGTCGCACTGTGCGCTCCGCCAAAGATCTCGGTCGATCTCG
CCGGTGTCGTGAGCGACTTGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNACCAAGTG
GATCCCATTCCTGCAAAAGCGGTAGTAAACGACCCGATTGAGCCGCACTTGCTGATTCTTCATGGTGATGGGACGGCCAAAGAGATCTTGCGACCGCGCG
ATATCGATCAGTTCCTTGAAGACTCCAAGTGCAGCGCCAGCGGTAATCGGAAGGAAATGTACTCGGGCTCGCAAGCGCCAAATGGTTCGAGCAGCAGTCC
GTTCAAGTATCGCGTGTTCTTTGAAGAGCTCTCAAGCAGCAGTAGCAGCCCAAGTTCAAGTGAGATAAGACCGTTGTTTCAAGACCCGAACCTACAGTAT
GAGATGCACAGGCTCATGAAGCCGGTGAATTCGGCGGCAAAGTATCTCCCTAATTACCCATCGATGCGAGTCCCGTGCCCACAGTTCACGATTGTGCGCC
GCATCGAGCAGTTCCAGCCATTGAGCGCATCAGAGTTGCAGGAAATGCATGTGTCGCTGCACAACTGGACGCAATGGCAGCAAGCCCGTGAGGTGAACAA
AGAGCAGTACAATGTAGTCGATCCCCGGGACGAGGACATGATCGCACAGCAGCTTGTGGTGCAAAAGAAGGTTTTGGCAGCATACAAGGCGACTCGCTCG
CGCAAGAGACTCGAGAAGCAGAAAGCACGTGAACTGAAGCGAAAGCTGCAGATGCAAGCGGAACATATTGATGGTGGCGGCGTCGCCGATGCAAGTGGCG
GTGGAGCATCCCACATGGAAACGGTTCAGGAAGGCGACGAGCCTCATATGGACGAAGGCGATGATGATTCAGACGGAGACGAATTTGATTATCTGAGTGG
CAGTGATAGCGCGAACGGTGGCAACCTGGATGTCGAGGTGGACGACCCAGACGAGCTTCTCTGGACCGCATTCTCGCAAGCTGATGCCGCAAACTGTGGC
AAATTGTCCATCGCACAAGGTACGTGCGTGGCGGCTTTGCTCGTATCTTTTCGCCGGGTGATTAATAAGGTTGTGCCATCGCGCTAATATGTATGTTGCT
CCATGACTCAACCATAGCCCGTCAAGCATTGGTACACGTGCTCGGTGTCGGCGTGTCGACGTCCGAGCTCATGGCCGCACTGATCCGATTCAAACTCCAG
GATCCGTCCCACGTACGTCGTCCACCTGTTGCTGTGCTCATCGAGTTCCTGCATATCTAATGGCATGCTTTGCATGATGGTATGGTGACAATCTCTCTTT
GATAGGTGAGCTTCGACACGTTTTCGGAACTTGTCAATTTCTTTCGAAGCAGCGACGAGGACAACAATGATGCCTCGGTGGTACATACAAAGAAAGGCGG
TGGTTCAGCTGCGCATCTTCCAAAGCTCCACGGTCTTTCAAGCGCCGCGTTCAGTGGCAGCGGACAGCAGCAGCAGCAAGAGAAGCAGGAGGCTCTGGCG
CCACGCAAATTCCCCATCGCCGCTGGATCCGCCACCGAAGCCATCCGACTCAAGAAAACTCTCGAGTGACTTCTGTACAGTGGCTTCACTTTTCTGTCCA
AACGATTCTGACTCCCTGTTACAAATACAGAAAAGTATACCACGGCGTAATTTACGTGCAATCGTATTACATCGTAAGTTACTTACACACCGTAGTTTAC
CTATCTTCAGCGTACCTTCGCTGTTGTCCGTAAACTACCTGTGTGTTTAAAACTGCTGCTTTGGGGACTGGCGNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNCGTCCCGCGCTTTTTTTTTGCTGTTGTTGTTGACATGAGGGCTTGTTGTTGTTGTTGGAAGGTCGCGCTCGCTCATTTGCAATTC
AGCTTCGTCTCGCGCGTCCGTCCGCTGCCCNNNNNNNNNNTCGTAGAAGGTTTATATACCAAAGATGACTGGCCCCCCATCGCCCAAGCGCCAGCGCACG
GAAGAGCCTGCNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNACGAGAAGGTGCAGAAGGTGCTCGAGTCGGTCGGCAAGGTCGAAGAGGA
GCTAGAGAAGGAGAACGAGAAGCAGGCGCAAGAGATCCTGGCCATCGAGACGAAGTACAACAAGGCCAAGCGCCCGGCGTACGTCAAGCGCTCCAAGCTC
TTTGAGGAGATCCCGGGCTTCTGGAAGCAGGCGGTGCGTTGTGCGTTTTGGTGGAGAAAAGACACCATTGGTTGGTTGAATAAGTGGCTGACTGCTGGTT
GCCATGTGTGTGTATATATATGTGTGTGTGGGCGCAGCTGTCGAACCACCCAATTGTGGGCCACTGCATTGACGAGAATGACGACAAGATCCTGGAGCAC
CTGAAGGCGCTCGACGTGACGTTTGTGGACGACAACGGCGGCTTCAAGATCGAGCTGGTGCGTGATTGTAGTTGGCGCATGCACCCACGTGCAAGAATGG
GGGGCAGATCCTAACCATTGTGTCTGTATGCAGACGTTCAACGAGAACCCGTTCTTCACGTCGACCTCGCTATGGAAGCAGGTCAAGTTCTCGGACGACG
AGGGCGTGGACGTCACGACGCAGGAGATCGCGTGGAAGACGTCGGACGAGGCCAAGGAGGTCTCGGAGAGCAGCTCTTTCTTTGAGGTATGTGCCGCATT
GTTGCCGCATTAGTCAATGATGTTAGTGTGATACTAATTGACTACACTGTGGTTTTCGTCATGTAGTGGTTCTCCTCGACGGAAGGCGACCAGGACATCG
CCGAGATCATCAAGGACGACCTGTGGAAGAATCCGGTGCAGTTCTACCTGAACGATGACGATGACGAGGAGGAAGAGGAAGGCGAAGAGGGTGACGAGGA
CGAGGACGAAGAGGGCGAGGGTGAAGACGAGGAATAGGCGCGCTGCTGTCGTTCAAACACGAGTCGTGCGATCGCATCATGCGCGCAAAGCAGTCGCCTC
GCCTGCCTGTGGATAGAAGAAGGCGTGGAAAACAAGACGGGGACAAGAATTAGGAAGTCGTTGACCCGTCTGGCGTCGCGCTTGCCGCATATACACACAC
TGAGAATCACCACGTTGTATAACTCGAACATATATAGCTTTTATCCATTAACGCCGTGTCTTTATCAGTCGTTCCACAGCATGATTGCATACTGAGCTGT
ACGTTTTTGTTGCGTCTAATGCGGACGCCTTGTGCGCTAGTCCTTCTTCTTCTTCTTCTGGTACATTGCGCTGGGCAGCCATTTGATCGGATTGCGGTTG
TAGATCCCCCAGTTCGGCAGCACCAGCTACGCACACACAACAGTAACAACAGGGAGAGGCGCGCACCATAAACACATGAGTCACGAGCGAAGGAGCATAT
GCATATATCCAATACACAATAAAGAGCGATTTTTTGCTGTTCTATATAAACGCACGACGGCGGGCGTACCAGAGTGCTGAGGACGGTGGCGGCGATCCAC
GCCTGGAAGGGGTACGCAAAGTCCTGCTGGAGATAGCCGTAGACCCACGCGGGTGCGCAGATGACCACGAACACGAGTAGCATGTAGCGCTCCGCGAGCG
CCTGTCCCTTGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCTTCGTCAGCGATTCCAGCAGCAGCAGCGCCAATGGAGCGATCGTCAGCGTCACGGCGT
CTTGTCTTGTAATAATGAGGAATGCTGGCTGCGTCCAAACGGAAACACGTATCATTTGCCAAGGCGCTAAGGGGAAGCAGCAGTATGCATTTCAATAGGT
TGTGTTTACAATAGATACACGAACAATAACCAGGGTTAATGGTAGTAGTTGCGGACACACTATGCTATTAGAGAGGGTTTTCGGTTGGCAGTTCTTTTAG
CATCACAAGCGAAACAGAAAGAAACAGAAAAGAGA