Description :
From Genome Similarity Track
Location :
Scaffold_2129:615- 4743
Transcript NameFunction/comments
Phypl_g14713hypothetical protein

Sequence
4128 bases(100 bases per row)
CTGGACTAGAACGAGATAATACGCTCGTGTCCATCCTCGTCATTCTGCAACAGTGCGCAGCCGATTGCATAGTCAGAAACGTCATAGACGACGCTGAATG
GCTTCGCCTCGTCCGGCAACGCCAGGACTCGCGCGCGCAGTAAACTCGCCTTGATGATGTCAAACGCATCCTGGTGATGAGGCTCCCATCGCCAGTCGAT
GTCCTTCTTCAGAAGGTCCGACAGAGGCTTCGCCAGGCCGGTGTAGCCCACACTGTACTTGTGCAGATAATTCGCCAGGCCCAACCACCGACGAAGGTCC
TTGTGAGACCAAGGAGTAGTTCAAGACGCGGtgaccttggccttctccggATTCGCTCGGACTCCAATGCTGCTGACGATGCAGTCGAGGCCCTTTGTCG
CCTCTGCGGTAAATACGCACTTGTCGATGTTGGCATAGAGCTGGTTAGTTCTTATGACATCAAACCTGGCCGTCCTCGGCACGGCTATGGACGAAGATGT
CGTCAATGTACGTCTGTGCGAGCGCACGCAACGGTCGGAGCAACTGCGTGACCGAGCGACTGAACGTCGCTGGGGCGTTCGGCATGACGAGTCACTCCCA
GAGCATACCGCTGAGAGTGCTTGCCGCGGTGAGCGGGATGTCACTCTAGCGCATCAGGATCTGGTAGTATCCGTCAATCAGATCCGTTGCGCTGTAAAGT
GTGCAGCCGGCCAGGTTGTCCAACAACACATTCTATCGAGGAATGAGCGTTTGGGCTGACACCGTAGTGTTGTTCAGCTTGTTATAAGCATGAACCATGC
GTCACTCCCTGTTCGGTTTCCGAACGCAGAAGGTGCCTTGGTGAAGACGTACGCTGATGTGGTGTCGAAAACCCACCATTCCAACTCCCACCTTATAGAG
GAATCGGGCCCAATCGATCTCGTGCCAGGCACTAAGTATTGTGTCACGAGACAACGGCCTCTACCTCGCGAGCAGTGCGAAGTCATTGATGCCTTCTTCA
CCGAGAAAGCGAAGGCTGGCATGGTGCGGGAGTCAAAGTCCCCGCACTCGACGCATGTACGTCGGGTCCTTCGGGTTCTTGGGCACCTCAGAACCCAAGC
GCGTCAAACGCTGAATATGGAATACCTCCAGGTCGTCATCGTTCATTACAGAGGAGGATTTCAGCACCTCAGGAGTGGACCCCGGCTTGAGGAGCACCAT
CTCCGAAATCTCTCCGGCCTTCAATTCTaccaagaactcgtccatcGGCCGTTTTTCGAGGTTTAGCTGTTCCGCTACCTcaagcagcgcctccaaATAG
ACAGCGCCTGCCTTGACCCTTAAACTGGTCTCTCCGTCGAAGACGTGGTAACACCCTTCGACTGGCCTTGTCTGAGGAGCCGTGACCATCGGCTCAGAGT
CGCTCCATCCGACTCCAGTCTGCGGTAGCCCCAGACCCGACGTTTGGCGATGTCAGTGTCGATATCATTTACAccgacgactacgacgtgGCACTATGTT
ACCCAGGTCTGGTGGTGCCTCCACGGCGGCATCTGGAGTCTCACCGACCCCGTTTGGAACTGTGTTACCCACACCGGAAGCACATTCCGCGTCTGCCTCT
TCAGTTATGGCCTGAGCGACCCCGTGGGGAACTATGTTTCCCAGACACGCCTCTAGCGACCTCCTAAGCGTCTCTTGCTGGATGCGGAACTATGTTACCC
GCTGGTAGCCCACCCGGTTAGCGCTGTCTAGCGCCACCGGCGTCGTGGTCTCTACGACCTCCCGACGTATAACGTCGGAAGGTGCTGACTCAGCACCCTC
TTCAGGGAGCCCGCCAAATACCTCAGCGGCTTCCATAAACTCTTCAGACGTGTCCGCATCCCGGCGGTCCTTCCAGGCGCCATTGTTTCTGGCAGAGGTG
TCACCAATGCTCTGCCAGAAACTGCGGGCCGGCTGGCCCCGATGGCCTTGCCGCGCCAGTCAATTCAAGGCTCGAGCTTCCCGAGGCACGACATGCCCAT
GATCAAGTCGTACTTGTCCATATTTAGAGCGAGAAATTTCTCTGTGGTGTCAAAGTCCTCGAACTTGACAGCAAGGTCTATGCAAGACCATTGGTACTTC
TACCACTGTACCATCGGCCAGCCCCACGGAGACCAGCCCTTTGGCTTTGCTCTCGCGTAGATCATCGATAAATCTGTCGTTATTGCCCGTGACTGTCTGG
CGGCGTGGGAAGTTCTTCGACGCTCCAGAGTCGATCCAAACGCAGAAAGGATGATCGTATCCTCGTACACGTGCGTGTACTACTAGCAGCCCACCGCAGC
CTCTTCTGTTCAAAAGTGCAAAAACTCTCAGGGGCTAAGCCGTCATGGTGCGCGCCACCCGCACACCACCCATGAAGACTTAGATCTTTCCCAGTAGTGC
GCCCCGCCCCTACTAGTGTCCCTCATTCCCCTGGCCCCCTGGTCGCGGCTTTTGCCAGTGACCCTTCAGAGCGAAGGGCTTGGAGGAATATTTCCTCCGT
TATCCTGCAGGACAGGCACGTTTAATGTGCCCCAGCTTGACGCAGCCATCGCAGCGAGTATTGCTATGCTCGGCCAAGCTGAAGTCCATCGGCACTGGAC
AATTAGGAGCGCCCCTGGCGGTGCTATTGCTCGGGTCTGCGTGGCCGTTCCACGCGGAGGTGGGGATACGAGCCTGCCTGTGGATGTACTCCTCCTGACG
GGCGATCTGGATCGCCTCTTCCGGGGTGCTGACTTGCACGCGGAATAGCTGCGTGCGAGCAGGGCCCACACGGAGTCCGTCCATGAACACCGTCACCTTG
ATGTGTTCAGGTAGGGGTTCCCCACCAGAGATGCAATTAGCGCGTATCGCTTGGATGTACTCATGTAGCCTACGTTTCTCTTGTTTGCAGGCAAGGAAGC
GTGAGCGCTGGCGATACTCATAGTTCGCCGGGGGCAGGCGGCTGGCAGCTGTTCACATAGCTGAGCCCAGGATGGGAAACATCCAGGAGACGTCGCTTCA
CGAGTGTACGCCCAGCTCTTGGCTCGACCGCCGAAATGCGAGTGCACAAAGACGAAACGAAGTCGAGAGTAGGGCCGCGTTCATCGCGAGCTCAACCTCT
CGGACCCAGAAGTGGATGTTCTCACCTTCCTTCCCATCGTAGGCCTGGACCTTCAGCCTCAAGAGCTTCGGCTGGGCCGGTCTCAGCGTAGCCTGGGTAG
GTTGTACCCCTGGACGTGAGCGATGAGTCCACGTTCGTAGGTGTCGTACGCGTTCAcgcgctcgacctgctcggATGGCGTTACCGCCGCCAAGCTTTGA
ACGATATCCATCCTAAAGATGCCTGTCATCTTCCGGACCGACTCAAACGGAGCGTCGACCAAATGAGGAAACTCTCCTCGATCCATGGTGGCTCACTTTC
TAGAGACCACATAGAGTTTCAGGGAGTCCAATCCACCCGCGTATGTGTCGGATTGACTGCAAGTGCTACCAAGTGTGATggctgtcacacgagcacgttg
cacagaggaagtgcATGCTTCGGAGGGTATATCAACCCCAAGTGAACGGTAGTTCACAAGCCCCTGGTGACATGTGGCGGCTGGTTCCCAAAGggaccag
cgccttgtcccaGCATCTTTCGGAGACCTTTGTGGATGATTGGTCAGAAAGCCTTGTTGGTGGTGAAGAAAGTCGCCCGTGACGCCTGTGGAAGACCAAG
AGTGATTGTGAAGTTTGAAGTCCGTACGGCGTTCTGATTCAGGACAACCTGGTGCGACATACTGAGCTCAAATGAAGTGCCGAGGATGACTCCGAACGAA
GAGGTCCGAGTCAGAACGACTTCGTTTCGACTCCGAACAGTCCGAATGCACGACCTGATTTGTACCCAGAATCCGACCTTCCAGATTTCCAGTATACTCC
GGACAAGAAGTTAACGACCGACCAAGCGGACCGACCGGATAtggcgctcgacgctcgtTGGATTTTCCGATGATGACGCTGACCGACCTATAGTGAAACC
TAGTGATTCGTACCTACATGTTGACTAGACGTCTAGCAGACGTCTTTCAGAGACCTATATTAACAGAGAGTTCGATTTGCCAGCTAAGACACAAATGCTG
CTCGGGGAAGTTTATTTGGCCTCGACAA