Description :
From Genome Similarity Track
Location :
Scaffold_1553:615- 4344
Sequence
3729 bases(100 bases per row)
AGCTCCAAATCTTCGGAAAACGCACTCCTCGTACGATTCAGCAATGGTCTGCGCAGTTCTAGACGCACTAGCTTTGGCTACCACGTATCCGGTAAACAGG
TCCACCCAAATCTACAATTCTGTGTTTCCTTTGAACGACTTGGGCAACGAGGGGATATGATCCATGGCTATGATTTGGAAAGGGTAAGTCGCTTGGATAT
TCCCAGGTGACTCCCCCTCGATTGTGGGCCTGCCCTTGCCTGTCTCACAATCCACACATTCCCCGACATACCGTTGTACACTCTTGAATAGTCCCCTCCA
GTGAAAACATTCCCGGATCCGTTGGTAGGTCCGACCAATACCCTGATGTCCGCCTTCCAAGCTAGCGTGATAGTGGTGTAGGACATCCTGTTGTAAGGTT
TCCGGCATCACCAGTCTCATCAATCCATCCCGATCCTCGTTGACTCTCTTCGTAGGGGGGCAATAGAAGAGCAAGTCATTCAGATCCACCGCGTAATCCG
TAGCGATAATGCTGTAGGATCTGGCATCTTCCTACTCAGGTCTCGTACATCCCCTATCAGATACTTCTTAAGTCCTAGGATCCACGCTTCCTCGTTCTGT
GCTTTGAGGATCCGCTCGATGCGGACTCTCTTCACAAATGTTTCCTCGAGAATTTGGGGGTTGGATCCAATCCTTCCTCTGGACCTAGTGACGGCAATCA
CCTGGACTGTCCTTTTCCCGGATCCCACTACCACCACTTCGTCTAGTCGGTTCAACGTAACGAGATCCTGATGCTCGGCCTCTCTCTCCACTTCAACACC
ACATTGATTCCGTAAAGCGGCACTGGCCAAGCTATCTGCACTGGCATTCCAATCTCGCTTGACATGCACCAACTCGTGATTCATCCAGCCACGCAGGTGG
ATCATCACCTTCTGCCGTAACAGTGTTAGGGCCCGGGCCTTGCAGTCAATCTCGCCTCGCACCTGTCTGATTAACAAAATTTGATCCCCAACAAATCACC
AGCCTTTTTGGATCTTGTCCCTTTAGTAAATTCAAACCCAGAAGGAGTCCGTTATACTCCGCCTCATTGACGGTGAGGCCTTCTGCGTAAGTGGATCTGA
CTCGTACAACTTCCCATCCGGGCAGTCTCCACAGTATTGCACTGTATGCTCCTCCTCCGCGTCGTACACGAGCGGATCCATCGAAACTCAGGACGTATAG
ATCCTCATCCACCTGTACCGTCGGGATCGGGATCTGGATCCGGCGTTTGGGCTCTTTCTTAGGAGCGATCCTAGTCAGCGCCGCATCCATCTTAGCTCGA
GGAGTGATGCTCGCGGCCAAGACTCCCAGGATCTCGTCTTCCCCTTTCGAACACTTCACAATCTCCAGCGTCCAAGGCGAGAGTAAAGCTGCCCACTGTC
CCAAACGTCCTTGTAACCCGGCCGACTTGAACAGCCAGGCTAGCGTGGAGTGTCGAGTCAGGATCCGGATGGGTCTCCCCACTAGCAGGTTGTAATTCAG
ATCCAACACGCGCAGGAGCGCGAGTATCTCTTTCTCCACCGCTCCGTAGTTCAGTTCATTCGGCTTCAGTGTCCGGCTGACGAAGGTGACTGGATAGCAG
ATCCCCTCATGTTCTTGAACCAGAGCTGCTGAGACTGCCCAGTCACTGGCGTAAACTATTACCGTAGGTTGACGTTCCGGATCGAAGTGACGGAGGATAG
GCGTGGTCGCGATTCTGTTCCCCAGTTCCACGAATGCGTGTTGATCTCGGATCCACCGAGAAACTGCCTGTTCCATGTTCTGATCCGTCGTCTCTATCCA
GCCTGGATCCAGTCTCTGTTGGTCCCGGGGTGGATCCAGCTCCTGTTTCAGGTCCTCTTCTGGCGTCCTACCACTTGGATCCCTTCGTGGATCCGGCATC
TTCTGGGCTAGTGCTTGTTGGATTTTCATCTGGACAGCTGGAGTGGTCATCGCGGCAAAATCTACCTCTCTCAATTCGTACAATACCGCTGCAAACAGGG
CGTAATCCTCGATGAACCGACTGTAGTAGTTCAAACTGCCCAAGAAAGATTGCATCGCCCGTAACGACTGTGGGAAGGACGAATCGGCTAATGAAGACAG
GTCCTTAGGATTCGCCTCCAATCCCTCCTTGGAAACTCGATGGCCTAAGTACTCCATCTTGCGCATCCCCCAATAGCTCTTTACCACACTAATAGAGAGA
TTCCACTTAGTACACGCCTCCTGTAAGGACGTCACTCTCTCGCACAGCTGATCCCACGATTCCGCCGGGATCAGAATGTCGTCGATGTAAGATCTGCGTC
CTAACACAGATGGGGTCCCAGGATCCCCTGGCTCCCCCACTTCGAATGGATCCACTTCCGTATGGCCTTCCCCAGACCCACCTGTTTCGGACTCCGGTAT
TCGGGTGAATCCATAGAGGGCGTTATCGATCAGGCGTTGGTAGATCTGGGGTGCGTTCTTCAATCCGAACGGCATCCGGTTCCACTCGAACAGGCCAAAC
GGTGTGATGAATGCGGATATTGCGCGAGCTCGATCCGTCATAGTAACCACCCAGAAACCACTGGCCATGTCTAGAGAACAGTACCAGAGTACTTTATCCA
GATCTTCTAACAGCTCGTTGATTAGGGGCATCGGATACACCATCAATCGAGTCAGACCGTTAACCAGCCGGTAATCAATGCACAGACGTATATCCACCCC
GTTCTTCTTAATGATGATTACCACCGGAGATGCCCGCGGGAACGTTGAGAAACGGATGATCTTGGCTTGCAGCAGGCCCTTAATCAGATCCGATAGTTTT
TCTCGGAACTGAGGTGCCACCTTCCGCACCCTCTGATCGATCGGTTTCGCGTCGCCGACATCGATGTCACATTTGACTCCGCGGGCAGCGGGCGGTAACG
CATTTCCTTTACCAATCAGCAGATGTCGGCTCTCCCAGATTTCTGACGCAGACGATCCACTTCAGCAGGTTCATTCGCCCCCGGATCCACTTGGATATCA
TCAATCGTGACTTCTTCTGTGGTCAGTGGTACCTCCGGGATCACCGCCATGCCTTCTCCCAGATCCTCGGCGTGTAGATCCCCGCCTTCACGGTAACAGA
CTTGCTCATCTTCCGTCTTCGTAGGATCCACCATTGGATCCAAACACCGCGACCCTCTTTCGCCTGGCAGTCCTTCTGTCTTCGGGGGATCAGGTACCCT
GGTATCAGGGAAACCACCAGTTGGATCTAGTCGGTCCTCTTACGAGTTTAAGCCCGACGGCTCTGGTTTGACTAGTGTTGCCACTCTCGATAGGGCAATG
GAAAGCTTGGATCCACTTGTGGATCCGCGGGATCCGGCTGTTCGGCTTTAGCCCTCTGCAATCCTTCATCCACCGACCCTGCGTTATCTAAGGGCCGACT
CTGGGGATCGTCCCCCGTCGTGGATCCAACCTCCATTGCTTGGATCTCAACCCGTCGATCCCTCTGCAGGATCTTTCGCGGAGTTGGATATGAAGGCCGA
TCCACCAAGGGGCCAGTTGGCTCCGCCGGGAGCTCCACCTCTCCGAGGGTTCGATTTCGGTAGTCGCCTCGTACACCAGATTCTGCCATTCTTTGTAGCG
GCGGGATCCCACTGACACATATCCAGGTCGCCTAGGGATACCGTCATTCGCTAACCATCGCCCGATCTCCTCATAATGGTCCAGTAATAGTCTCTTATCG
CTGACGTTCGTGACCTGGAGGTATTGTGA