Description :
From Genome Similarity Track
Location :
Scaffold_864:6149- 9946
Transcript NameFunction/comments
g12258.t1hypothetical protein

Sequence
3797 bases(100 bases per row)
CACAGAGCGGAAGGAGTACAACCAAGGCAGCAAATTGAGACAACTGCTTAGTGCGAAATATGTGGTGGAAATCAAGATCTATCTCGGGACCAACAGGCCT
CCTCTGAGCGAAGTTCTCTCGTTTTTAAACACGGTCGAGGTCCGCTTCCGTGGGTATGCCAAGAAGAAGATGTCTGCAACGCTGAGCAATTCAGAGCCGG
ACCCAACGCCAATGCCGTTCCGACTTCCTGAGGCTATGGTAACGGCAGCCCTCATTAAAGCAGTGAAGAAGGAAGCTGAAATGCAGGACGTTGGGACGGA
GGTGGATCTTTGTTCTCCCGTAGATGGAACAACCAGTGTCGATGCTGACACCGAATTGTGCTCGGTCCACGTTGAGGGGGCCGGTGACTTTTCGAAGAAC
AGACTCGAGGCCATGAAATACCTGTGGAACATGGCCAATGCCTGTTCTCGTGGAATGCAATACTACTTGTGGCTCATGAGCGAGGTATACGTCCATTTCT
CGGATGAAGGATCACAAACGGTCGCAACTGAGATCGCCAACGCCTGAACAGACGACAGAATCTCAGGATTTAGCTTCGACGTGCACTGGGCGCACATCTA
CTGCGTGTGGCCCGGCGTATGGTTCAACGATATCATCATTCATGCTTTTCTGGAAACGCTTTCGCACAAGTACAAGAAAAACAAGACGATTTTCCTTCCA
CAGCTGAGCAACCCGGCACCAGAGAAAGGTAAACGCATTCCCCAAGCCACGCTCAACGCGCTCGAGACGACATCTGAAGACTTCGTCTTCATGCCGATCA
ATTTGAACCGATGCCACTGGGCGTGCATCTTAGTAGACATGACGAAGGGAACACTCTTGTGCTACGACAGCGTGGATAGCCGTCCTCACCACAAGCTTCT
GTCGGAGTTGGCATCGGAGATGGTGGCAAGATCGCTGACCGGGTTCACGCACATCGCTGTGCACAACCCGTTGCAGAAGGATAGCAACAATTGCGGTCTC
TTCGTGTGCCTCTTTTTCTGGAAGCGACTGTGGAAAGACGTACACAGAGGAAGGCCTTGCTCGCAGACGCTGGCAGATTCTGCATGCAGTTGTGAACTTC
GACAAGGAGAAGAAAGAGGATGCTAGCAAGTAGATCTAAGTCTAATCAATGAGCATTGCATTACGAACATTTTCACTGTCAACTTCACTTTGCGTTTATG
TATTGACCAAGTTTTGGACATGTATCGTAGTGTAAATTGGCCATGTGTGCGGAACATGTATTGCCCAGGGTTTGAGTAAGTTTTGTGCATGCAGATGTTT
TGAAAGGCCAAGCCATCAACGTTATTATAGTGTACGTGTCATACTGTCACTCTTTAATAGTTTAACTGACTTCTTCGACATTTATAGCTGGACAGATTGA
ATGGACAGGCTTGACCGACAACACCCACGCACTCTCACTCTCCATTTTTTTGGCGTTCCGCCAACATGTATCGTCCATGTTTTAGACATGGCCATGAACA
GGTTTCTTAACCAGAATTTATTTCCAAATGACTTCTGCTTCCGTCATTTAAAAGAAACTATTTCCGCTTCATTTGAAAAAAACATGGACGTTACCTGCTG
ATACCTGCCCAATACATGATAAAGTAGGCCTACCCCTTATAGAAAACATGGGCAGCATCAACAGCCTATTAAAAAATATCCCCGAATCTCGCTCAGTCAA
TATCCAGGATAGGGAAGGGGTTCTAAACTTCTCCAGCTAATAACACTCATAGTAAAATGTTTGACTATTAATAGGCCGAGCCGATACTCAAAACGTTTTG
GGGCAAAGCCACCCTATAATCAAACGTAATATGTGTACGACACACACCTTCTACCTTGATTTACTGCTTCATTTACCCTTTTTACAGCTTTTTTTTCGTG
GTATTACCATTCAGGTTAGGGTTATCATTATAATTCCCCCTAGGGAACAGTTTCGATTAAAAAAAAAACTCCTTCTAACGACGTCGCAAGGCGACGATCC
GGCGCTTCATACGGAAAGTCACGAAAATTACCCATCTCGAATGTGTTAACAGTCACTAAAGTCCTAACAAACTTTATGGAACCCACGAAGGGTCGCTTTG
TATAAGGTACCCAATGTAGCCAAATTTTCGATAGGATTTGTGATCGGTGGTTAGGGGACAATGGTCAGCCATTGCGACCCGTCGGCCCTGATTTGTATGG
CTTTTGAGTCTGTTTTGTCCGAAAACTCAGTAAGGCAGGGTGCACATCCCCCGTAAGAACTCCCAGGAGGGCACTGCCAGTGTACTGCCAGTGGTCGCGC
TGACGCTACTGATTTTGGAGCCAAGGAATAAGTACACCTTTTGGTTGTGGTCCACGCGATTCGTGAGCGGTCGTATTGCAAGCCACACTTCCCCTTTGGC
GTGCTGCGGCACAGGCGTGATGGAGCTGCTGACGACTATCGAAACACTGTGCTGGAGGAAATGGAGCAAGACGCTTGAACCTATTTTCTACTGTGACTGA
CCTACGTGCGTTTATCTGCGCTACACACCCTGCCCTCAGCGTGACCGTGACTGTGAAGTTGTGCTGCCTTACGTCGGAGCGCTTAGCAGGATGCTGCGGC
ACTCGCGTCACATGCATAGATATAATGAAATGCATCGAGTTCCACGAGGAACAGGATTCGATGCGTGCGCTCGATCTGTCAGTACTGAATACGCGGATTG
CTCAAGTCGTGGTGTGGGATGACACTAAGCCGCACACGGTGCACCAGGCCAACATGGACTTTCGTCCTGGCTGGGTGTACGAGTTTCACCGCGTGGCGTA
CGTTGGTTTGTACGATGGTATTGCTACAGGAGCAGTACAATTCGACTGTGAAGACACGAGGAAGGTTCGTGAGGTTTCTCCGCCAATAACAAGGCATTAC
CTGTAGATTTACGGAGGATCGCGAGCGTGCTAATGTTCTCTTATACACGCTACGGCAGCTGGTGCTCTCTGAGCTTGCTTTGCCTAGCCTCAATTTTGCG
TTGTATAGCGAGGGTGACAATGTCGCGTTGCAGGGTTGAGGTTGCTTTCGTGGAGTTTAGCTGCGCAGTTGCTCGAAGGACGTACAAGGATCTGCGAACG
TGTCGTAGGTTCGGTTCTCCAAGATGCGGCAGAATATGGCGTGCCTAATGGGTTGGCATGCGTGCGATCTGAACGTGTGATTTCACCCTGTAAAATTGCG
ATGACAGCAGCGATCCCCATGTCTTGCGCTTCGTTGAAGCTGGCAAGGATCGTTCGACGGAAATGGGTAACCCCATGAACGAAGCTCATGCTGCGCTGCT
AAAAGTAGATTTGTCACCAGCTTCATGCATAGCTCTAAGGTGTGGTGTGCTCAAAACGCAGCGATGCATCGAGTACGATAAATGAAAGCCGTTGTAGCGC
GTAGCAGTACGTTTAGGGATCAAAGGCACAGCACTCGCATCTGCATGCAGGTTTTCCTCGTAGGAGTGCGGCCTACTGACTTCGAGATGCGCCAAAACAC
CCATTCAACGATCCTGAACGAAATTTATGATGAAGGTTTTTGAAGCGAATGACGTATCATCGCTGGTTGATAGTAGTTGTATGTTATGGAACACACTGCA
AACTACTAAATTTGTTCTCGGCTTTCAGGTTGCTTGCACTAACTATGGTTGTGCGGGTGTCGACATTTATACTATTGAGTTTGGCAACACGCCATACAAA
CACAGGCTTGAGCTCGTAGTAATGCAAATATGATCTCCGCTAACGACGAGCTACGCATCCTACGCATCTGACCGGTGTGACATTGAACCTGACGACG