Description :
From Genome Similarity Track
Location :
Scaffold_240:6149- 8345
Transcript NameFunction/comments
Phypl_g5804hypothetical protein PHYSODRAFT_474675
Phypl_g5805hypothetical protein PHYSODRAFT_472178

Sequence
2196 bases(100 bases per row)
AGTCGCGGCTACAGCAACTTGCACAAATGCGGCGTGAGAGGGCTGAGCACGGTCTCATAtctgacgacgaggacgagggcagtgacgaagagcaggaaga
cgccgccaACCACCCGGTCCTCCTCCGTTCACGCGTCCGAAGCCGCACGGCGTCTGTGGTGCGAGCTGGTCGCACTCACTCGCTGGTCACGAGATGGCAT
CGCATGACAATCGGTCAGGATGAATTCGGCCAGGTGgaggaactgctgcgcgacaactTCGACCCGCTCACCAAGTCGATCCCCGAGCTTGAGAACTACT
CGTACCAACTGTTCGAGGGGCTCGTGCTCATCGGCACTTTCCGGATCGAGGCGATCTCGCTGCGCATGTTCATCGGCGAGCTCGCTAGCAGGTACCGCGA
CGTGCCCTACCACAGCTTCTACCACGGCTTCGACGTGGCTTTGGCCTCGTACGCACTCATGCGCTCGCCCGAGGTCTTGTCGGTCATCAAGGAGATTGAG
GCGTTGAGTCTGCTCATCGCAGCTCTgggccacgacgccgaccacCCGGGCAACGACAACCAGTTCGAAGTGGACTCGAACTCGGTGCTCGCACTCTGCT
ACAACGACATCTCCGTGCTCGAAAACCACCACGCAGCCACGACGTTTGCTGTGCTCAGGAGTAAGTCAAGACGTGACCGTCTTGTGCTTGAGTTTGCTTG
TTGAATGTCGCGTCCTAACAGTCTGTTGCTACTTTCGTGCTCCCCAGTGCCAGGGTGCGACATCCTCCGAGACCTGAGCGCCAACGCCCGCGTGTCGGCG
CGCACGCACATCGTTCGCTGCATTCTCGGCACCGACATGAAGCACcacacgaagctgctgtcggaaCTGGCAGTCGTGGGCACCGTCCACGAGTTCGAGA
ACGTGCCGGAGGGTCGACAGCTCATGCTCAGCATGATCATCCACGGCGCCGACCTCGGGTCGGTGGGGCGGCCTCTCCGCGTGGCGCTCAAGTGGGTGGA
GCGCGTGTGCACCGAGTTCACGCAGCAGGCGGAACGCTCGGCCGAGCTCGGCCTCAACGTCCCGCCGCACCTGCTCAACCTGCAGGATGAAGCCGCTCGC
TGCCGTCTGCAGATGAACTTCATCGATTACCTCGTGGCGCCGCTGTGGGTGACCATCAGCGGCCTCGTTCCAGCCGCCAAAGCCACGCTCGAGAACCTGC
GGACCAACCGACTGTACTTCAGCGAGCAAGCTACTCTACTCGCTGCGAAGCCCCCGAGCTAGAAGGAAAACTACTGTAGCATCATCCCCACCCCACCCCA
ACGTGAGGACAATTAGAGATCGTAAGTTATTGTTGCAGCAAGGCAGACTTGTCCATTGAAAATAGCTGTCGGGAAGTGGTGGGGCGCGACGCTCGACACG
GCCAACGGTTGAGCATGTGGGGCATCGGactcgcgctggcgctggtggcctGCGGTGTCGTGTTCATCGTGCTGGGGTTGCAAGCgcaggaggcggccga
gaaggcccAGAAGGCGGCACTGTTCAAATGGACGCCCAGGGCCATGGCTGATGATACGCCGGCGTCGTTCCTCAACTGCTCCACCTTCGCTTTCGCAATG
GACGCGCCCGAATTCACGAGCTTCTACCTCTGGAACCTCACGAACGCAGGAGATCTACtgggcggcggtggtggtggggcagtgcagccgcagctgaagc
agcttggGCCGTACACGTACGAGAAGCGAACGCGCAAGCTCAACGTGACTTTCCACGCGATCCAAGACGACGCGTACGCCTCGGACAGCTACGGCGCCGT
GAGTTACCAGGTGGCCTCCACGTACCATTTCTCCAGTGAGCGCTCAAACGGgtccgagagcgacgtcgtcgtgacGCTCAACGCCTCGTACGTCCGCCAC
TTGACCAAGCTTCACGCCCAGACTGGCCGCTCGGAAAGGTTTCTCGCGGCCGAGTTCGCGCACGCGCACATCCGCGACTACACGAAGCATTTGCAGAGCG
ACCTCCTCGCTGCCACAAAAttgcgagcgctgcgtgctCTGCTGCCGGAGATGGTGGCGGATGTGAAGCGCGAGGGCTTGACGGCGGTGATccatcgaca
gcgacgccgagtcgGGGACGCCGATTTACCAGCGACACTCGTTCGGATGCACGCGGTGGCGCTCACCGAGCAGATCCCCGTCATGCTGCGAGACGT