Description :
From Genome Similarity Track
Location :
Scaffold_249:61468- 63416
Sequence
1948 bases(100 bases per row)
TGGATCTCTTAGCGACAATGGATTTATCGGGGTCGACTTCCCTCCTTCAGGCACAAGCGCCATCCGAATCACGAGAGAAGGATCACGATATGGCATACGC
AATGCAACGTAAAACAATGGGTGTATGCGCAGCTTAGCGGAAGATTGGGTGCGTAGGCAAGTCCCTTTTTAGCGATGACCGTGAACGGCAAAATGAAGTG
CAGACGCAATTTTGACTTGAAGACGGCAGACATTACATTTATAGGTAGTTTTTGAGCATTTAATAGGACTTGGTCTCCAACTTTATAAGAATCAATACAT
CCTCTGCCCTTAGCATCAGCTTGTTATTTTTGTTTATCTTGGCTATCAGCCATTGCATCACGCACATTTGTAAGACACCAAAGCGCGTCGTGAGAAACTC
GCTCATTTGTTTCTGCATAGTGTTAAAGCTGGTACCAGCAGAGTTGTCAGCAAACGATCCCCCGCCAAGCCCGAAACCCGCAGTGGTATCGTGAGGCTAT
ACATATTAAAGGGAGCAAAGCAGTTCGAGGTATGTACAGCGTTGTTTAAAGCAAATTCGAAGACAGGGAGCATCATGCTCCAAGTCTTTGTCGACTCAGC
ACAAACACTGAGAAGCACATCTCCAATGACGTGATTGACCGCTCAGTTTGACCATCGGCCTGCGGATGATCTGATGTGGACATGTATAATCGTGTGCCAA
GAACCTCGACGATGGAATTCTAAATTTTCCAGTCAATCGAGAATTGCGATCAGAGATGATTGCCGAAAAACACGATCAATAAGGAGCAGAGCTGTACCTG
TACCATCGAAGAAGTGCGGCACAGCCGCTAAGTGAGACATTTTGCTTAAACGGTCAACAAAGATTACAATCCGTGTATTGCGTTACAGTCTTTGGGAAAT
CCAAAATACAAATTCCATGATGATGAGCTCCCGACACCCAGTGGTCACCGGTAAACTAGCGAGCGGCGCAGACGAATGTGCCGAGAATTTGACCCGCTGG
CCCGTTTTACAGTTATACACGTATGTGCTCACCCATTTGTAGAGCTTAGGCCACCAGCAGTGTTGACTCACAAATCCGTATATCTTTTCACGACCCATAT
GCCCACCGAGAGCAGTGCCATGGACCTTAAAGAGGATTTGATACTTCAAATTTTCATCGTGAGGTACAACAATGGGAGCGGTATCCGCTACATCGGTGCG
ATAGAACAAGAGACCATTATCTATGAAATATCGATGTAAGCTGGCACGCAACTGTGCCGATAAATGAATGTCCGAGTCTTTGCACCCCTCAATCCCAAGG
GCATAAAACAATGCCACCCATTGAGAATTCCGTCGATGTGTCACACGAATTAACTAACTACTCAATAGGAGACGACAAGGTCGTGACATGATCAAGCTCA
TAGTCGGGACGACGAGATAGGGTATCTGCCAACACATTTTGTTTGCCTGGATAATACTTCACCTCGAAGTTATATTCTGCAAAGAACAAAAGCCAACGAG
CCCTTCTCTGATAGAGGTGAGGCGACTGTGTCGCCGTGCGTAATGACGCATGATACGTGTAGACGACGAATGGCTTGGAGCCGAGCAGATGAACTCTAAA
CTTGACGAGTGCATACTTCATAGCAAGTAGCACTTTACCATGAACTGGAAATTCTTTATATCAGCTTTCAGCTGACGAGATTCTAATGCGATAACTCGCT
CGTGGCCTGCAGAATCTGTTTGTAACAGGGCAATGTCTATGATAAAGTCGGATGCATCGTAGACAACACTTTGTGCAACGCCAAATTAAGAGCATGGAGA
AGACTCTCATTTATTGCTCGAAATGCGTCAGCATGGGTGTTGTCCCAGCGAAAACCTATGTACCTCATAAGGAGATCAGTTAATGGCCGAGCCATATCAG
TGTAATTTTCACTGTATTTGTGTAAGCAATTGGCGAGGCCAAGCCATT