Description :
From Genome Similarity Track
Location :
Scaffold_4:61465- 63401
Transcript NameFunction/comments
Pytap_DAOMBR444snap_masked-pag1_scaffold_4-abinit-gene-0.81Myosin

Sequence
1936 bases(100 bases per row)
ACGAACCTGCTATTCTTCACGTGCTGCGGAAGCGCTTCTTCCACGGGCTCATTTACACGAGCACGGGCTCCATTCTTGTGGCGCTGAACCCGTTCCGGAA
GGTCGACTTGTACGCAGACACTGTCAAAGAGCGGTATTACTCCATGGGCGGCGACCCGGAAGCTGCCAAAAAGCTCTCCCCGCACGTGTACTCGGTGGCT
GATAAGGCATTTCGGAAGATGCTTTCGACAGTGCGTGTACAGAACCAGAAAAGCGACCAGACCATTCTGGTGAGTGGAGAAAGTGGCGCTGGCAAGACCG
AGACGACCAAGTTGATCATGAACTACCTCGCTTTCGTGTCACTGAAGCGCAAGGCTCAACGCGCCACGGGAAAGCAGGGCAATAGTTCGGAGCCGACGAT
CCACGACCGTGTGCTGGAGTCGAACCCCATCCTCGAAGCCTTCGGGAATGCCCGCACAAATCGCAACAACAACAGTAGTCGTTTCGGCAAGTTCATCAAG
CTCGGTTTTGCTTCAAGTGGAGAGATGCTCGGCGCGTCTATTTCAACATATCTCCTCGAGCGTGTTCGACTCGTGTCTCAAGGTCGGGGTGAACGCAACT
ACCATATCTTCTATGAGATGCTGGGTGGAGCATCTGGAAGCGAGCGAGATGAGCTGGCTCTGCTGGACGTGAACGAGTACAAATATCTAAATCAGTCGGG
CTGTACACAGCGAATGGATGGAGTCGACGATGGAGATtcATACAAGTTCACGAGACATGCGATGACGAGTTTGGGGATGAAGGCTGAGGAGCAAATGGAT
GTAATGCGGATCGTCGCGGCTGTTCTGCATCTCGGTAATGTTGAGTTtGTGACAGAAAAGGGAAAaGATACTTCTCAAGTCGACATGTCGGCATCTGCAT
CCAGCATTGAAGCGGTATGTCGACTGCTTGGTATCGAGTCGGAGCTACTGCAGAGTACTCTGTGCACGAAGCGAATCAAGGCTGGGCCTGAGTTTATCAC
GGTTCGACTCCCGCTCGATCAGGCCTTGTCAACTCGAGATTCTGTTGTCAAAaCACTGTATTCCAACCTATTTAACTGGCTTGTGGCGCGTATCAaCTCG
TCGATCGAGTACAAGGAAGAGAAAGGAAGTCAGTTTATTGGCGTCGTCGACATTTTCGGCTTCGAAATCTTCGAGCACAACTGTCTTGAACAGTTGTGTA
TCAACTACGCGAATGAAAAGCTGCAGCAATTGTTTGGCCGCTTTGTTTTCCGCATGGAGCAGGACCAGTACGTCGCGGAAGAGATCCCGTGGAAGTTTGT
CGACTATCCGAACAACGACATCTGTGTTGAAATGCTTGAGACGCGACAGATGGGTCTGTTCTCGCTGCTTGATGAGCAATGTCTCATTCCGAAGGGCAAC
GACGAGAAGCTTGCGAACAAGTTTTACGAGGCCTTTGGCAAGCATGAGTCGTTTGGCGTGACCAAGCTTCAGCAAGCGAAGCGTCAATTCGTCATTCATC
ATTACGCAGGAGATGTCTGTTACTCGACTGGAGGCTTCTGCGACAAAAACAaGGATCATATGCACCCTGAGGCTGGCGATTTGATGAGAACGTCCCAAAT
GGCATTCGTTCGTGAGATTTTTGAGCAAGACGAAGTCTCAAAACGGAAAAGCGATGAGCGACCTGACGCCCGTCGTCGCTCAGGCATCATGTCGTCAACG
GTTGTAACTCAATTCAAAACCCAACTCAACTCTAtGCTTGACACCATCAaTGCGACGGAGCCTCACTTTATACGTTGTATCAaGCCCAATGATGTTGTGA
GCTCGAGTGAGTTCGATAGAAAGCGATTAATGGAGCAGCTGCGATGCAGTGGTGTGCTCGAAGCTGTTAAGATCTCAAGAAGTGGCTACCCAGTTCGTTT
TTCTCATGAAGATTTTGTCAAGAACTTCGTTTGCAT