Description :
From Genome Similarity Track
Location :
Scaffold_1151:6146- 8085
Sequence
1939 bases(100 bases per row)
GCCATTGTTTTGGTACTCACTGCACCTCAACagaaagaagaagcccaTGACCTTAGCACCATAAGACACGGTCGTGAGCTGACGTGAAATTGAGTGTCTG
GTGGAGGATTCGAAGAATGGACACCGTGATTGGTGGTTTGGGTCGAGGAGAGGGTTGGAGTCAATGAATGTCTCGGATTGCCATGATGTGATGGGGAAGG
AGGATGGCGTTGAAGCCGAACTCCCAACGGTGATACCATGCAACTGCACTGATTTTGGACTGGATGGTCTGTAGTGAATTTCCTTTGGATGCGGATGAGC
CACTGCCGTATCGGTAGTAGTACACGGCGAAGAGTACAAGTTGCCGTGACGTGACAGCTAGATCGTTGGGGATCCAGGGACTATACTCCATGTCTGTgca
ccatctccaccactgcTTCCATGAGGCTTGGTATCGCTTGCGCGACGACTCGACCAGTGAGTTGGACTGCAGTTCGCGGAGAACTCCTTTAGATTCGCCT
CCAGTGCTAGGGTACCTGCACTTGACGCCATGAACATGACAAGATAGACCACACACGGGAGTAAGGTGAAGGTTACGCCCTCAAACCTGCGTCTGACATG
CGGTTCTTCGACTCCAGGAGATGTCTGGCGAATAGCAAATTTTGAAAACGGCTTCGGCGAGTCCTATTGCGCGGTTGATCTGTCGGCCGAAGACGTTCTT
GGAATGTAATCGATTGATCCAGGAGACCGCCGAGACATTACCACTCCAGCAAATCACGTGTGGAAAGAATTGCGGTCCCCAGCACCAGGCAGCGAGTGCC
ATGTAGAAGTGCTCTCGCGTTGATGGTAAAGCCCATTGATTCGTCATCCTTGCTGAGACGAAGCTCCTCAGTATCAAAGGGCAGCTGAATGAACTCATTt
cgcgctggatgaagtaTACCGAGTCCTGAGTCTGAAGCGTCCATGTAGATGTTGATGATCGGCTTGGGGAGAGTACCAAAAAAGTGTAGCGGCAATTTTT
CGAGATGGCCATCCGAGAGAATATGATGGAGTCACCGTAGGTCACGACGTGAAGCTTCACTTAACCGCATCGACTGGAATGAGCGAAGCCGGTTACACAA
taccagaagctgctggaagaaaGGCTTGGCTGACCGAAGACACGTCGTGAGGTGACGGAGACTACCAAGAAGtttctggagctgcttcttaCTGACCCTC
TCAGCGGCCAACAAGACCGATCCTCGGTCGAGGCGTTTCTGGACCTTCTCGGAGGGCATTAACACTGTGCGATCGATGGTGTTCCAGATAAGGCCGAGTG
CTTGCTGTTCTGTGGACCACTCAGAGAACTTGGAGTCATTATACTGTCCAGTCCGAGGATTGCCATCATGCTCAATCGAAGTGTTGATTGATAATTCGAG
GCGAGTATCGTGATCCGGTTCGATAAAGATGTCGTCATCGACCCACTCGTATCCAAAGAAGGCTTCATCGCCAGTGCTTTCAGATACCGATGCTGGTGAG
TTGTTGCTCACAAGCCAGATTATTGCCCTTCCAAGGGCGCTCTAGAAGGCGGGAGAGCCTGACCACCCGAACGGAGCCACCAGGTCAATTACGAGAGCTT
TTGGTGCTGGAAATGTTGCTCCTATCCAGCGCAAGTGCTCGGCATGAAGCATGAGGTGGTGAAAGGCTGATTTGACGTCTCCTGTTAGCATTTTGATCAC
GATGCCGGGATGAGTTCTGGACAATGTCTCGGTGCGTCGCGCAACGGCTACAACGCTGATGTACTCGATATCGGGAGCGCAATCAACATCGAAGTAATCA
TTCTTGGACGATGTCTCTGGGAATGAACGATCGTGAATTGGAAGGGCTTCGACTTGTGGGTCCACACAGCACCGAATGGGCTGCTTTGAATATGATACCA
CTGATGAAGTAGTGATAGGTTGACGACCAGATATGTCAC