Description :
From Genome Similarity Track
Location :
Scaffold_73:61455- 63051
Transcript NameFunction/comments
Pytve_DAOMBR484maker-pve_contig_73-fgenesh-gene-0.24Dolichyl pyrophosphate Glc1Man9GlcNAc2 alpha-1,3-glucosyltransferase

Sequence
1596 bases(100 bases per row)
AGAGCGAGAAGGACGCCCGTCCGTCGAGTAGGTCTTGGATCGTTTCGTGTCCGTCCGTGTCGGAGATGGACCGCTTCCGGGTCACCTTGGGCTTTGACGC
TCCGCCCTTGCCGTCCTCCTCACTGTCACTTGATGCCGCCTTGACATAGCAGTGGTGACCCAGCAAATATACAAAGTACAAGGGAGCGACGTACAGGTAG
ATGTGCTTCATCATGAGCAGCACGGCGTACAGGAACGCGCCTTGCAGGTCTTGCTGGAGGCGCAGCTTGGTCACCGACAGGATCAACAGCCCGAGCAGCA
TCCCGTTGTACTGGAAGTGGATGTGGTCCACAAACAGCAAGCCCGCGTCCAGCACAGTCACCAGCATCACCGTCAGGCGCTTGTACCGAGAGTAGGCAGG
CTCCGTGGTCGTGACGCTCGGCCACGAGCCGCAGTAAGCCCAAATGGCATAGAAGAGCACGAGGTCCGAGACAATCACCGACAGCCGCTGGAAATACACG
ATCGAAATCTTCATGATGGGAGTGGCCGAGATCTGCAGCATGTCTGGGTCGACGCGGGCACCGACGAGTGCAAGCGCATACTCGAACACAGCGAAGAACG
GGGGGTAGTCCAGCGTCCATTCGCTCGTCGCCTCGTGGTACCAGCGCTGGGTCGGGAGCGAATACGTGAGACTCAGCCAGTTGCGGTGCACCTCAAAGTC
TGTGCTCGTGTAGGAAGGAATGAGCAGCAGCTTGACAGCGACCGACGCGAGAAACAGCGATGCGAGCGGCACATCGAGCCGAGTCTTGCCCATTGCGTTC
GGTATTCAGTGAGCGCGCGAGTATCTTGGAGTGACACGTGACGAGTGTAACCAGTTGGCATACAAAAATCAAGTCAATGGTTACAGTGTAACCTGTGGTA
GCAGAGTGCATGCTTTTCAAATACCTTAGCTCACATGTCATAAGCGCAACATGTCAATAGCAAATCCATAATTTCTTGCCCTATTTTAATCCATAACTTC
TATTGTCAGTTGCAAATATTTTGGCAATTCCGACTGTTTTTTGCCGGATTTACCACACCCGATTTAGACGACAGGTCTGAATTGAGTGAGACAGGAATCA
CGTCATATTATAATTAGGGTAAAAATTGACTGGTTGCAAATCCGTTTTACTCGATAGCGGTCAGTTTTACCGTTTTATTTCGGCATTTCAGACTGGCATT
CCGACCACAACTGGCTCCTGGCATTCCACTTTCAACTGTGTGTGAACTGAAGGCCTGTGCGCGGTGGCGGACGCTATGACTTACGCTGACGATTTCCGGT
GGCGCGCTGTGGTACTCATTCACGTGTATGGGATTGCGATTTCTGAGATTTCCTCACTGTTTGGCCCGAAACCAAGGTCTATTCGTCGATGGTATGCATT
GTTCTTAAGAGATGGAGTGGTGACTGAGCGCAAAGAGAGGAAGACGCAGTCACGGNNNNNNNNNNNNNNNNNNNNNNNNNACGTCAAGACCAACCCAACG
TTTTATTTTGAGGGATTGCAAGCGCACATCAAGCAGAAGTTTCCTACGCTGCCCAATGTTTCTACGGCTACGATATGCAGAGTCCTTAATTTTGAC