Description :
From Genome Similarity Track
Location :
Scaffold_198:6145- 9196
Transcript NameFunction/comments
Pytul_var.sporangiiferummaker-pug3_contig_198-snap-gene-0.15Haloacid dehalogenase superfamily protein

Sequence
3051 bases(100 bases per row)
GCGCACGCAGAGAGGGGGCGGGAGCGGGAGACCGACGCAAGCAGAAGCACGGGGGAGCGGACTAAGGCTCGCCGTGGGGTATTGGTATGGATTGGCGTTT
CGCTAACTGGTATTTTGTATGGGACTGCGCCGAACAAAAATGCAGCGGGCTTACGTGAGTCGGTAATGAAAAGAGGAGGAGAGGGGGGAGGGCGAATGTG
GGGCATTGGTATTGGTCGAAAAGACGATTCAATGCGTTTTAACAGCCAGTAGTATTCTGGAATAAGCGATACGAGAGATGCAATTGGATAGAATACAAGC
CGGTGATAAATGTCCAGTCAAAAAAGCGCAGAAATGCGGCATGGCGTGGTTATTCTGGACGCGGCGTGAGCATGAAGGGCCTCAATGTGCGCGGCGTGAC
GGAGTTTTGCCGTGCCGTCGTGCAAAAGCCGCATCTGCTGCTGCCACAGATCTCCGTCAAAGGTGCGTGCGCATGCGCAGAGCTACTGGCGTGTGGGTGC
TTGTGTTGATCGTACGCGCAAAGTCGGCGACTAAATGAGCTCTTCGCTCGTGTGCGCATGTGCAGATTTGAACGATGTGTCCTTCCAGGCGCTCAAAGAC
CGAGGCTTTCAAGGCGTGATCTTTGACAAGGACAACACACTGACGATCCCGCACCATAATGAAATCGCTGCACACTTGCAGGTGCGTGCGAATGGATGCA
TGTCAAACAACATGTCGGGCGTAGCTGCTGACGAGCATACTCTATTTGTTGTATGCGTTTGTACTGTGTGGACGTATAGACACCGTTTGACGAGTGCAGG
CAAGTGTTTGGTGACCGCGTGCTGATTTTCTCCAACTCGGCAGGCTCGAATGACGATCCGGGCTTTGTAAAGGCGCGCGAGATTGAGGCGAAATTGCACA
TTCCCGTGCTCCAACACAACGAAAAGGTATGGAATGCAAACAAACGCATGGCATGCATGGAGTGTTTATCCATTGCGCATAGCTGCACTAGAGTTGTTTA
CGGTTCGTTTCTGCGTTGCATATAGAAACCAGGCGGCATTGTGCACGTGCAGGCGCACTTTAAGAATGAAGATCCAACAAAGCTGATCATGATTGGCGAC
CGGTACTCGACCGACGTGCTCTTCGGCAATATGAACGGTACGAGCACGAGCAGCGCTCTGCTTACCCCCATTTTGCCATAAGCATGTGACGTATTCAAAT
GGGGGCTGATGGTTGTTCTCTCCATTACATATAACAGGGTTACTCACGATTCGAACAGATCAGTTCACGCACACAGGCGAGGGCATCGTGAACCGCCAGT
TGCAGCGCATTGAGAAAGCAATGATCCGCATGCTGCTCCGCTCCGGTGTGACGCCACTTGAGCACCCGTTGATGGCAGTGCATACCAGCGAGGACGACAA
AGCACGCAAATGATATTTGAAGTGCTCCCTAAAGTGCTGATGTAGAGACCAACAAGCCCGAATGCGCTGAAGATAGAGAAAGAAAGACGCAAGACAAGAT
AGAAATGAAACGATTTTGGTGCTGACTGTGCAAAGCTGAGCTGATGACGTGTCGCCAACGCAAACAAACAGATAAACACCAACAAATCCTGCAAAGCAAA
CCGTGCAAAGCAAGCAAGTTTGGCGTGACTCTGGCATTGGAGACGCAGAAAGCTGCAAAGCAAGCAGGAAAAGCAAGAGAACACAGTTGCAAGTATGGAT
ACAAGTGGCCCCGTTTTGTTTCACTGTTTCTATGCTTTCGCGCTTCTCTTCCCAGGTGCTCTATTTTGTTGCCTGCTTCTTTATTTTGATGGCAGGGGGG
AGGGAGGAAAAACCAACCAACTGTCACTTTTGACAAGCAACGAGATTCATTCTCATTTGCTGAACCCAAGTCAACTGATTTCTCTGGGTACAATAATGCA
AGGAACGGCTCATGTGGATGTCGTGTGCAAGTTGGTCTGTCGCTTGTGCAAATCGTTCTCAACTGGGAACAAACCAGTTTCTCCAGTGCACAGCTATGTG
CTGTATGGAGGACGGCGATATTTGTGCAAGTTCAACGTGCACTTTGCGCCTACTACTGTACTAAAAGTCTATACACAGTATCCACCCATTGGATTCAAAA
CCACAACTACTGTGGCTCCATACAATGTATTCAATATAACTTCATCCTGCCGTTCGAGTGATCATCCGATGAGAAGGGGGCAGTGCAGTATGAGCGGTCG
ACTGACGAGTGAATGTTAAATATGAAAAATGAGAAAAGAACGCCAACATACAGTAGAAACCTGAAGTGTCAAACGCGACCATGTGTCGGAAAAGCATGTT
GACGCTAAAGTACCCCCGCTACCTTCTTTTCTGTATCGACTTTGTCACAATCTCATTGCCATACTTGTGGTATTACGCTGTCACGTTGCGTCCTTGCGTT
TGCAGAAATATCCAGGGCAACAGCGTAGCACGGTCCCGTTTGTCATGCTTGCGACTACGATTTGAGGAATCAAGGCTGCACATGATTGACAGGATAGAGC
CATGATGATGGAGCGAACAGCGCGGTCCATTGATGCTATATGTCGAGTATGGAGTGACATTTAAAGGCAGCACGATATCACGTAAGTAGTGCGTTCGTGT
GGCTTACATGAAGCATATGTGTGCGTGAGTGCTCTGGCCAGTTGGCCAGAAGTCGGTTCAAGAGTTGTTTTTTTCCAAGTAGATCTTGAACCGTTCTATA
CCAAGCCAACAAATTAATAACATTATTGTGAGGGGGAAGACCCAACCCCGAATTTATAGGGTTCACTCTATCATGCCCTTATGCAGGCGTCTCTTAAAAA
ATCAGCCAAAATGCCCTACTAAATAATTTGAGATAAAACCATTTTGCGACAAAACTTATAGCCCTAAACGGCGCTTCGTGTTCTCTTACCACAATAACAA
TATTACTAAGGGGAGAATCAATCAAGGGAGAGAAAGCGCGCATTGCATCTGCTGTTTGCTTTTTCCCAGCCGTTAGGGTTCTGTAACCTGTCATACCATG
CGGCTTGTCTGGCTTCCGCACATGTTGGCAAGCAAATCGGCCTCTTCCAAG