Description :
From Genome Similarity Track
Location :
Scaffold_194:61436- 63370
Sequence
1934 bases(100 bases per row)
GGGATTCTTGAGCGTTTCGGGGGGCTGTCTTCGCTCTCGGAAGAGACCACGTACCGACGGTACGGGCGAAGACGCCCCACGTGAAACGTAGGAGGCGTAC
GCATCCTACGGGGCTGCTTGATTGTGTATGAGTTGCCTTGGAGGTGCACTACACGACAGGGCCCAGTCTACTTGGGTAGTAGTAACCTACTACCCACGTT
AGTCGCTACATGTCTGGGTAGGTTAACCGTAGACAGTAGGACTAGGCGACTAACAATTAATAGAAGCATATTTGATCTTCCATTCTTGTCAGTGTTCCGT
TTCTGTCGGTCCACCGCGTTAGAGATGGAGACCTGTACGAAACGGATAACTGCTTCTCGAGTCAGCAGAAAATCATCTATTGACTCGGTTTTGTTTGATC
TAGTGCGCTTAGTGGGAACTGTGGATTTAACGTTGTTTTCGTCAGCGAGGGCGTCATCTTCCTCGCTAGAATAGCCATTGGCGATGCTGAATATACTAGC
ATCGTCATTATCATCAGAGTCAGTGATATCTTCCTTAATATCACTGTGGTTCTCTTCTTCGATGTCGATTAGTCGACATCGGTGTCCTTCGTGGTGACGT
TCAAGTCACCACGTGACGAGCAAGAGCCAGAACGGTTTTTTTCTCGAGCGAGTCCCTCCATCCCTTGAACCAGAGTCACACTCTAATAAGGCCGGTATAC
GTGGATGGCGCAAGACATCCCGAAGAACGGTGTATGTGTCGCGACGCATGCACCGAGTTGTTGATGGCAACTGTCTGCCATCAGCAAGGACCCACTCCAA
ATCGTTAACGAGTGGGTTATTATCGGGGTAACCCGTCGACTGTACAAATGCACAGTAGCTCAATTGGGAAGGCGTGGCAGCGTCATCTCAGGGGTCACTG
GTTCGATCCCCGGTGGGGGAAGAAGTTAAGCCTCCGAGGTCTGATGTGATGGGGTTCACCAGCACTGTCCTGCCAGACAGTTACATCCCCCACTTTTGTG
GGACACGAATACCGATCCGTCTGACCATCTACTTCAAGATGGTCAGAAGCTGGCATCTTCGACTGTGTTTTAAGAGTATGGAACACGGATTGCCAAACTC
CGCCGTGAACCACGGATCTCTATCTGAGATCAGTCCACGGGGTGAACCGTGGAGTCAAAAAGGACGTGTCAGTAAAGACACGAGCACAGCCCTCGGCTTT
GATTGCCTTTGGTACAGCAACAAGATGTACCATCTTGCTGAATCGGTGAACAAACACAAGAATACCATTATTCTTGTGGTCGTCTTCAAAGATTGCGAAG
ACGAAGTCCATTGACACGGACTGCTAGCACTCTGCCAAAACGGGCAGAGGCTGGAACGGTGCACAAGATGAAGAACTAGGCTTCACCCGTTGACAGACCT
CGTAAGCACGAACTTACTTGCGCACGAGCTGATACTGACGGGGCCAGTTAAACTCGCGACTGACCGTAAGGTAGGTATTTTCTCTACCACGATGCCCACC
TGTTGGTGTATCGTGACACTAATACATGATGTGCAAACGCATCATGAGTGGGAACGACGACACGAGGGGTGTCACCGGCAACGGGTATATATTACAGCAA
CCCGTTGCGTGTTGTGTAACGATCCGACGAGGATCGGTACAAAGCCGGTAATCCCTTTAATGATTGTCGGGATGGATTTACCAAATGATCCATCAATCGC
AGAAGATCGTTATCTTCCGCGTATGCTTTCTTCACGTCATCAAGCAGTGTTGACGACGAAACACTTTCAACTAGTGTTGCAACAGTGGGCTCAGCCTCAC
TGTTGAATCGCGTGGCCGGCTCGAAATCGCGCCGGCGCGAAAGCTCGTCAGCGACGACTTTAAGTCGTCCTGGGTTTTAATCGACGGAGAAACTATACTC
CGTGAATAGAGAGCCATAGATGTGCGGGTACTTG