Description :
From Genome Similarity Track
Location :
Scaffold_1048:6143- 7501
Transcript NameFunction/comments
Pytir_DAOMBR486maker-pir_contig_1048-snap-gene-0.5Yvh1

Sequence
1358 bases(100 bases per row)
GAGGAGGAGGAGTATGAGGTGGAGGAGCTCGTGGACGACGCGCCGATGCACATCTATCGCCGGCTGTTTCTCGGATCCATCGATGCTGCGCGCAACGAGC
AGGCCCTCAGTAAAGCGCGCATTGCGTTCACGCTGGCGCTGCTTGGCGCTGAAGACCGCGGCGAAGGGATCGCAGCAGCGCCTGCGCCGCATGAAGGAGT
CGCTAGTGGCGCTGGTGGTGCTGCTGGTGGAGTGAACAATCACCAGCTATCAGCACGCGATGAAGCTGCTGTCGTCATGCGCACGCAGGTCGCGATTGAA
GACGCGCTTGACGAAGATCTGTTCCACAAGCTGCCAATGATCCTTGCTGCGCTCAACAACATCCTGTGTGGAAATTGCTCGCGTCACTGGTGGGTAATGG
CATCTGTTGTGGCCCGCTGCTAATATTTCGTGTGCTTCATGTGTGTTCTGTAGTGAAGAAGCCGAGCGCGCAGACAAGAACGTGTTGGTGCACTGGTAAG
TACTTCGAAGTAGCAAGCCAGACGATTGTCCACTGCTTCACTGCGAACACCATGCAGTTATGGTAGGTTCACTGACATCGTCTATCGTCTTTTCTAATAG
CGTAGCAGGTCGGTCACGCTCGCCGTCGGTGGTCGCCGCATGGCTGCTCACCCAATCGCCAGGCGACAAGTACCCGAGCATCAAGCACGTGATTGACGAG
ATCAGGTAACGAACGTTATAGCCAGCTCTTTTGAGGGGGTGTGTTGAAATGCTGCAGGATCAGTATGCATGTCTAACACACTCGGCACCCTATCATTATG
ACCATGTATTATTGTATCGTATTGCAGCTTTATCCGCCCGTGGATCGAGATCAACGCGCACTTCCAGAGCGAGCTGCAGCTTTTCCACGCGGTCGTGGCT
TCCAAGGAGCTGCTGCAGCAAGACACCGTGATGTCGCTGATGAACCGTAGACGCAAGCTGCCTCGCGTGGACTTTGGCGAGTCGCTCGTTGCCGACATTC
TCGCGGGCAAGAAGACCATCACCATGCGACTGCAATCGGACCTCGAGGACGACTGTAACTCGGACCTGAAGGCCGTTTTCCCGCACTCGACTGTGTTCGC
AACGACAAGATTATCCGAAAATATCCACAATGTGTCCACAACGACAACGACCAGCACTCTGACAAGTCCAGCGCGACAGCCGTTTGCAGTGCTGTATGTC
CAACAGGTCACAACAAAGTGTCTGCATGAATTGGACACCCAGGACCTCCAAAAATCGGGCTTTGCATCAGTCCCACAAGTGCTCGTGGTGCTCAAACAGT
TTTACCCTCACGTGACGGACGCCACGCCGCTGCTCATGCTGCACTTTGCGTGCATCGG