Description :
From Genome Similarity Track
Location :
Scaffold_1239:6140- 7936
Transcript NameFunction/comments
Pytiw_DAOMBR242034maker-piw_contig_1239-fgenesh-gene-0.2GAF domain-containing protein

Sequence
1796 bases(100 bases per row)
ACGGAATGGCTGAGCGCGATCGCTTCAGTACTCTTTGGTATTCCGCACAGCATCGAGTCATCGAAACCGGTTAAACGGGTGTTCCATGCCACTATTTTGC
CATTTTGGCCAATTTGAAGCGAAATGGACCTGTCTGCGCCGACTCCAGCGACTGCCGCGGGCTTTGCGTCGCAGTGCGTGTGCAGCGTGCAGCTCCCGCT
GTACGCGCCTAGCTCCATCCACACACTTGAGTCATTTGAGCGCCACCGCCTCACAGGTAGATCCGATGCTGTGGCCTTTGTGGTGTCTGGCTGTATTGCG
TAACTCTTCGCACACACGACTGTATGAACATTTGCTCAATGTGTATGGTGGTTTGTGTGCGCCATCCAGTGGTCGACATCGCGTGCAAAGACGTCCACAG
CGGCTGCTACTCGGGCAACGAGCACGCGCGACAGAGCGTGGAGCTCAAGTTCGGCGACTTTGTGGCTTTCTACCAGGAGTCGTTTGCTGGTCGCTTCCAC
TGGCTGCAGGGCGTCGACGACCTCGAGTTCTACTTGTGCCAGTGTCCGATCGCAGTCTTCCGCCCCGATGTGACGCACATCGAACCAGTCTTGCCCAGGA
TTATGGACGACTTCACCATGTAAGTCACGCCCACAACAACATCAACAGCATTGTACCTGGGTCCACACTAAACCGAATGTCTCGGTGCATTCCTGTCCAT
TCATTTTCCACAAGTGCAGCCCCGAGTCTCTCTTAGCCGACTCTCACTCGCTGAGCCAAGTGAACCTGTGGATGGCTGTGCACGCGAGCCGCACGAGCCT
GCATTACGATGCCTACCGCAACGTGCTGGTGGTGCTCTACGGGCGCAAGACCGTGACGCTCTACGCGCCGTCCGAGGGCGGCAAGCTCTACGCGTTCCCC
GTGCACTCCAAGTCGGCCAACCACAGCCAAGTGGACGTGAGCGACCCAAACCTCACTTGTCACCCACGATTCGCGGACGCCAAGCCGCACCTGCGGGTCG
TGCTGGACGCCGGCGACGCGCTCTTCATCCCCGAGGGCTGGTGGCACCAGGTCGACTCGGACGCGTTCACGATCGCTATCAACTTTTGGTTTGACGGACT
GCAAAAGCAGCTGACTAAGGAGCCACTGGTGACGCCCTACTACGCGCGCGTGCTCATGCAGGACCTGCTGAGGTGCGAGACCGAAGAGTACCTTGACGGG
CTTCGTGCAAGTGCCATAGCGAAACAACAAGAGCGACAACGTCTACCAGGAGCAATAGCAGGCGACATTGTGCAACGAGTTCTCCAAGCGTCGAGTCAAC
AAGAGAAAGAGCAGATTTTCATCGCGAGTGAGCAGAATGCCTCGGAATTTGAGCTCTTGCAGCGAAGTTTAGCGGCTCTGCACGCCCCAGAGTGGTGTCT
GCTACTGGAGAACGCCAGCGACGACTTTGTAGCGTTGCTCACCACATTTTGGGAGTGGATGGCGACAACACGGCAAAGAGCAGCGCAGCATCAAGAAGAA
GAGCTCATGAGCGTCGTGTTCAGCGCATTCTCTGATGGCGGCGAGCAGATTCGCAGCCAGCTGCTCGCCAAGAAAGACGCGTTCGACAAGAAGCTTTGTG
CTCGAGTGATGCTCGACACCTTTGGCCTAGCTAGCTGAAGGCAGCCAACCGACAATGTCACGGTGAGTCAAAAGCCCAGTCATATTATCTAGCTTATTAT
TTGTCTATAGGATGACTTGCTTATACTTCTCTTTCCAGATATCTGCGATCGTCTCGGCGAGGCGCTTGACGATCGAGTATTGCATGGTCGTCACCT