Description :
From Genome Similarity Track
Location :
scaffold_33:614- 4568
Transcript NameFunction/comments
g7947.t1hypothetical protein

Sequence
3954 bases(100 bases per row)
TCGCACTCTGTTGTACGAGATGGGGTGCCGTACGCGTCTAACATGGTCGGTTGGCCGTCACTTTAACGCAGGGACAATATGCGATCAATGGTGGCTGCGC
GGCGGAGCATTCTTGTGAACAGCGGCCTTGACCTGGGAGACATCTTTGTGCAGTACGATTCTCACCGCACTGGGTTCGTGTCTCGATCGATGTTCGCCAC
TCTCTTGCGAGACTACAGCATTTCCATGCCGGAGACCACGCTACACTTCCTGATGATCCAGCTTGCGAAGCCGTCAGACACGACGTCTGTTTCGTACGTG
CGCTTCCTCGAAATCACGGATGTAGGAGTTGCAAGGAGCGCTTCAGCGAACCCACCGCTCAGCCACGGACTGGAGAACTCCCCGGCTCGCTTCAGCAGTT
GGACGAGTGGCCGGTAAGGATTCTATCATTGAGGATGAAAATTAAGACGCTCATCGTTTCATGCTCGTGGGTCTTGCTTTGTGTGTGACAGATCCAACCC
GTTCGAGCAAGAAAGTGCCGCTCGAGGTTATGCGATGCAAAACGCGGTTCCTGTAGCTACTCAACCCGCCAGAGTTGTGAACCATGCGTCAGCGAGCCCC
GAGTTCGCAACACCTTTGCTCAGACTTGGATGGGTCTGTCGAGTGTGCGCACACCAGCAGATAGTAGATTGGGCCACTCACTGTGAAATTTGTGAAACAT
CAAAACCGCGGCCAGGGCTACGCGGCGAAGGGTATATCAAATGCTTGCAGTGCAAGTTCGACAATAACTACGACATGGAGGAGTGTGAAATGTGTGGGCG
TCCACTCAATGCAAGTAACAAAAAGATGTCGAAATCAGAGAAGAAGCGCAGATCGAGAAAGCGCTACGTCTCAAGCTCTTCGTCGAGTTCTCCGTCTTCA
TCCTCTTCTTCAAGTTCATCGGGCCATCGCCGAAGTAGCAGGCGCAAATTCGAAAAGCAGTCCCGCTCGGCTCGATCAAGTCGAAAGAAAGAAGAGAAGA
AGCCGCGGTTTCAACGAGGCGAGGAAATCCAAGCCATTCCTCTCGGCAGAAGAGGTTATGAGATCGGGGTGATCGCACGCGTCCGGCCCAATGGTACGTA
TGACATTGAGTTTGACAGCGGCCTTTACGAGAAGAACGTCGAGGAAGACTGCGTCCTCGAGATTTCACGTGCGCGCGTTATCAAGGCCAAAGACTTATCC
GACAGCGAGGAAACTAAGCCGAAAGCTAAATGCTCCGATGACGACAATGATCCTGGGTACGAACCAGGAGATCGAGTCGAGGCTCGTTTTCAAGGCAATG
GACGCTTCTTTGCTGGTACAATCAAGAAATGCAGAACAGGCGGATTGTATGATATCGAGTACGATGACGGTGAAGTTGAGCTTCGCGTTCGTTCGAAGTA
CATTAAGCGCGAGGAGGCGAAGAATCAGCGGAAGCCTTCTCCAAAAGAAGATGACGTATCTACCTCTGAAGTGCCGTGGGCTAAAGGACAGAAGGTAGAA
GCCAAACTGCGTGGGTGCACAGACTACGTGAGATGCGTCGTATTTCACGCAAATGCAGATGGCAGTTGTGACGTGGAGCTTGACACTGGTGAGCTGGAAA
AACGAGTTCCGGGAAGAAACATTCGCGCCCGTGTGAGCTCGCCAATAAAAGCGAGGCCTACCGTCCAAAGTGAAGAGGAACCAGTCCGACCAAAGAGACC
CTTGGTGAAGAGGCCTAGTGCACCTTCCACAAGTGAGGATTCGTGTGCCCAGCCTAAATGGAGGTTCAAGCAAGGCCAAGCTGTCGAAGCAAAGCCTAAG
GGAAGAGATGGATATTTCCCCGGCGTAATTGCTAGATGCCGCTTGAATGGCTCCTATGACATTGATTTTGACGACGGAGAAAAAGTATTAGCAGTATCAG
CCATCACCGTCCGCGCTATCGAAACAGCACCCGCTGCCAAGAAGACAACAACTACGGCTTCACAGGAATCACTCAAGGCAACCATTGATTTCAAAGTTGG
CCAACCAATTGAAGCCCAGTACAAGAGCAAGAGCAAATTCTACCCGGGCGTGATCTCTCGCTGCCGCCTGAATGGCACGTACGACATCGACTACGACGAC
GGCGAGAAGGAGACGGGTGTGGCGGCCGAGCTGATCCGGGCGGTGGGCAAGAAGGGCGGCGCTGACAGCGACGACGGCCCGAAGCAGAAGAAGTTCAAGG
AGGGCGACAAGGTGGAGGCCCAGTACAAGGGCAAGAGCAAATTCTACCCGGGCGTGATCTCTCGCTGCCGCCTGAATGGCACGTACGACATCGACTACGA
CGACGGCGAGAAGGAGACGGGTGTGGCGGCCGAGCTGATCCGGGCGGTGGGCAAGAAGGGCGGCGCTGACAGCGACGACGGCCCGAAGCAGAAGAAGTTC
AAGGAGGGCGACAAGGTGGAGGCCCAGTACAAGGGCAAGAGCAAATTCTACCCGGGCGTGATCTCTCGCTGCCGCCTGAATGGCACGTACGACATCGACT
ACGACGACGGCGAGAAGGAGACGGGTGTGGCGGCCGAGCTGATCCGGGCGGTGGGCAAGAAGGGCGGCGCTGACAGCGACGACGGCCCGAAGCAGAAGAA
GTTCAAGGAGGGCGACAAGGTGGAGGCCCAGTACAAGGGCAAGAGCAAATTCTACCCGGGCGTGATCTCTCGCTGCCGCCTGAATGGCACGTACGACATC
GACTACGACGACGGCGAGAAGGAGACGGGTGTGGCGGCCGAGCTGATCCGGGCGGTGGGCAAGAAGGGCGGCGCTGACAGCGACGACGGCCCGAAGCAGA
AGAAGTTCAAGGAGGGCGACAAGGTGGAGGCCCAGTACAAGGGCAAGAGCAAATTCTACCCGGGCGTGATCTCTCGCTGCCGCCTGAATGGCACGTACGA
CATCGACTACGACGACGGCGAGAAGGAGACGGGTGTGGCGGCCGAGCTGATCCGGGCGGTGGGCAAGAAGGCGGCGCTGACAGCGACGACGGCCCGAAGC
AGAAGAAGTTCAAGGAGGGCGACAAGGTGGAGGCCCAGTACAAGGGCAAGAGCAAATTCTACCCGGGCGTGATCTCTCGCTGCCGCCTGAATGGCACGTA
CGACATCGACTACGACGACGGCGAGAAGGAGACGGGTGTGGCGGCCGAGCTGATCCGGGCGGTGGGCAAGAAGGCGGCGCTGACAGCGACGACGGCCCGA
AGCAGAAGAAGTTCAAGGAGGGCGACAAGGTGGAGGCCCAGTACAAGGGCAAGAGCAAATTCTACCCGGGCGTGATCTCTCGCTGCCGCCTGAATGGCAC
GTACGACATCGACTACGACGACGGCGAGAAGGAGACGGGTGTGGCGGCCGAGCTGATCCGGGCGGTGGGCAAGAAGGGCGGCGCTGACAGCGACGACGGC
CCGAAGCAGAAGAAGTTCAAGGAGGGCGACAAGGTGGAGGCCCAGTACAAGGGCAAGAGCAAATTCTACCCGGGCGTGATCTCTCGCTGCCGCCTGAATG
GCACGTACGACATCGACTACGACGACGGCGAGAAGGAGACGGGTGTGGCGGCCGAGCTGATCCGGGCGGTGGGCAAGAAGCGGCGCTGACAGCGACGACG
GCCCGAAGCAGAAGAAGTTCAAGGAGGGCGACAAGGTGGAGGCCCAGTACAAGGGCAAGAGCAAATTCTACCCGGGCGTGATCTCTCGCTGCCGCCTGAA
TGGCACGTACGACATCGACTACGACGACGGCGAGAAGGAGACGGGTGTGGCGGCCGAGCTGATCCGGGCGGTGGGCAAGAAGAGCGGCGCTGACAGCGAC
GACGGCCCGAAGCAGAAGAAGTTCAAGGAGGGCGACAAGGTGGAGGCCCAGTACAAGGGCAAGAGCAAATTCTACCCGGGCGTGATCTCTCGCTGCCGCC
TGAATGGCACGTACGACATCGACTACGACGACGGCGAGAAGGAGACGGGTGTGG