Description :
From Genome Similarity Track
Location :
Scaffold_88:6139- 7530
Sequence
1391 bases(100 bases per row)
TGGTACGGGCGGAGACGACCGCCAATAAACGTAGGATGAGTACGCATCGTGCGAGGCAACTCGATCGTGTACGCATTGCCTTTGCGATGTAGTACACGGA
ACGGGCCGATGTCATTGGGCAGTAGTTTACTACTATTCACGTTAGTTACCACATGCTTAGGTAGATTTACCGTAGAAAGTAGAACTAAGTCTCCAACATT
AAATAGAAGAACGTTTGCTCTTCCATGTTTGTCAGCATTCTGTTTCTGCCGGTACAACGCGTGAGCGATGGAGTCTTGTACAAAACGGACCATTGCTTTT
CGTGCCAGCAGGAAATCTTCTTCTGTATCACTTTGGTTTGTTGCAGTGCGCCTTGTGCGCACCGGTAAGAGGTCATCTTCTTTTTCAGTGAGGATGTTCT
CATCCTCGCTGGTGTAATCATTGGCGATGCTGGATATACCAGCATCGTAATCCTCATATGGGTCAGCAATAGTGTCATCACAGTTGATTAAGTTACCTTC
TTCGATATCGATTTGATCGACATCGGCAACGTTCGCGTCGTCGATTACATCGACACGTGATGAGCAAGAGCCAGAACGGTTTTTGCTCGAGCGAAAGCCT
CCCCCCTTGAATTAATGTCACACTCGAAAAGGGTGGGTAGGCGTGGATGGCGTAAGCCATTCACGAAAAGAGGTGTATGCCTTGTCGATGCATGCACGGA
ATTGTTGATTGCAAACTCCACCATCGGTAAGAATTCGCTCCAATCTGTGAAAGATTGGACGTATCCTCAAAGTTTCTCTTCGAGGACGCGGTTGGCGCGT
TCTGTCTAACCATCAGCCTCGGGATGGTCAGAAGTAGACATAGCCACACTTGTTCCGTGGGATCGGAACACGGATTGCTTAATCGTCGCCGTGAAACGAG
GATCTCTATCGGAGATTAGTTCACGGCGTAGATTGTGAAGTCGTAATACCGTGTCAAATGACGGCACAGGTACAACCATATGCTGAGATTTACTCATTAA
CTGCAGCAAGATATATCATCTTGCTTAATCGGTCTACGAACACAAGAATACCATTATTCTTGTGAGCGTCTTCGGGGAAATCGAAGACGAAGTCCATTGA
AACGTACTGCCAGCACTCTTCCGGGATCGGTGGAGGCTGTAGTGGGGCACGGTATGAAGTACTGGGCTTCACACGTTGACGAACCTCCCAAGCACGAATG
TACTTGCGTACAAACTGATACTGGCGGGGACAGTAAAAGTCACGACTTACCGTAAGGTAAGTCTTCTCCCTACCACGATGGCCACTAGTTGATGCATCGT
GGCACTCGTACATGATGCGTAAGAGCAAATCATTTATGAGTGGAGACGACGACACGAGGTGTGTCGCCGGTAACGGCTGTATAATACAGCA