Description :
From Genome Similarity Track
Location :
Scaffold_40:61380- 62654
Sequence
1274 bases(100 bases per row)
AGAGAGGGCGTCCGCAAGCACGTTGAGCTTGCCCGGCTTGTATTCGACGCGGAAGTTGTATTTCGCGAAGAAGGACAGCCACCTCGCCATCCTTTGGGAG
AGGTGAGGCGAGTTAGTCGCCGTCCTCAAGGACGCGTGGTCTGTGTAGATCACAAAGGGCCTAGAGCCCAGAAGGTGAACACGGAACTTCGCAAGGGCAT
ATTTCATTGCCAGGAGCTCCTTGTCATGGACAGGGTAGTTCCGCTCGGCGGCTTTGAGCTTCCTGGACTGGAACGAGATGACTCGTTCCTGTCCAGCCGC
GTCGGCCTGCAGCAATGCACATCCGATGGCGTAATCGGAGGCATCGCAGACGACGCTAAACGGCTTCGTCTCGTCCGGCAGGGCCAGGACAGGAGCCTCT
TGGAGACTGGCCTTGATGCTGTCAAAAGCATCCTGGTGCTCTTGCTCCCAGCGCCAGTCGACGTCCTTCTGAAGGAGACTCGACAAGGGCTTAGCGAAGC
CCGCGTACCCTGCGCTGTACTTGTGAAGGTAGTTGGTCAAGCCCAACCACTTTCAAAGATCCTTCTGGGATCGGGGCGTCGGCCATGCTGCTATGGCCTT
GACCTTGTCTGGGTCAGCCCGAACGCCCACGTTGCTTACGAAGCAACCGAGAACTTTAATCTCTGGTGACGCGAAATCGCACTTGTCGATGTTGGCGTAG
AGCTTGTTCGCTCGCATTACGTCCAACACTCGACGGAGGTGTCCTAGATGCACCTCCATGGCCGTCTTGCCTCCCGCGGCACGGCTATGGACGAATATGT
CGTCGAAGTACGTCTGTACGAAGGTACGCAAAGGGCGGAACAATTGCGTCACCAGGCGATTAAACGTCGCCGGGGCGTTAGACAAGCCCTGCGGCATGAC
GAGCCACTCCCAAAGCATGCCGCTTGGAGTGCTTACCGCGGTGAGCGGGATGTCGCTCTCTCGCATCAGGATTTGGTAGTATCCGTCTACCAAATCCAGC
GCACTGTACAGTACGCTCCCGGCCATGTTGTTCAGCAACACATCCTTTCGTGGGATTGGTGTTTGGGCCGGCACCGTTGCGTTGTTCAGCTTGTTATAAT
CGTGAGCCAGACGCCATTTTTCGTTCGGCTTCCGAACGCAGAAAGTCGGCGTCGAGTGCGGAGATTTCGACTCCCGCACCATGCCTGCCTTCGCTTTCGC
GGCGAAGAAGGCATCAATGACCTCGCACTGTTCGCGCGGGAGAGGCCATTGCCTCGTGACACAATATTTTGTAC