Description :
From Genome Similarity Track
Location :
Scaffold_121:6138- 13440
Transcript NameFunction/comments
Pytir_DAOMBR486maker-pir_contig_121-fgenesh-gene-0.2Dynein light chain/pantothenate kinase
Pytir_DAOMBR486maker-pir_contig_121-snap-gene-0.17Notchless family protein
Pytir_DAOMBR486maker-pir_contig_121-fgenesh-gene-0.4CD27-binding (Siva) protein
Pytir_DAOMBR486maker-pir_contig_121-snap-gene-0.25Serine protease family S10

Sequence
7302 bases(100 bases per row)
TCTGCTGTTCCCGGCTCTTCTTCTCGGCCTCCAGTCGTGCTTTCACCTTCCTCGCCGCGCGGATGTGGATGTTCTCCTCCAGTTCGCACTCAGCCTCGAG
CTGTGCGAGCCGCACTTGCTTGTAGTACTCGGCCTCCTGCGCGCACCGCCGGGTCTTTGACACAAAACCCTCTTTCTTTCTGGCTGGATCTGCTAGCTTT
GCTGTTGATACTAACAGCACTTTGCCTTTAGCAGTACTACGTGGGTCGCTGATCGATGGAGCATCCTGTCTTGATGCTGCCTTCGCGGTGTTGCTGTTCG
CACTGCTGGCACGAGCCAAAGCGCAGTGGTGGGGCTTTGTTGCTGAGACCTTGCTCGATTTCGTGCCTCTATCCACTCCGCCCTCAGTGCCGGTAGTATC
GCTCAGCACAGCCGAGAGCTTGAGTTTCCCCACAACCGCTCCATCGGAATGCCTTGGTGACGATGCTGATGCTATGGACATTGCTCGCAGGCGCTCGATC
TCCCTGCGGTACTCCTCGAGCTCGACTTCAAGCTCTTGGTATCGAAGGAATTTGCTGCTCAAAGCGGAATTGCGACGAAGTATCAAGAACCATTCAATAG
CACAACAGCAGTACGACGTATTGAAGGTCGTACCTGCTGTACTTTAGCCGATCCAGCTCTTTCTTACGCTCCGCTGCGATCGCTTCGGCGTTCACAACCT
GCGGTTATCAACAGAGGGCAGTCACTATGGGATGTCCAGACTCACTATGAACGCGATATCAGGTTAATGCAGATAGATCCAACTCACTCGCTGCTGGTTT
TCCATCACAAGGCGGTCGATGAGCTCCTGCTTGCGCTTCTGCGTGAGTTCAGCATCCTGCGGAGCTCGCAGCACGGCAAACACCGCTTGGAGCTATTGGG
AACACAGTAGCACATATGAAAGCACGGTTACTCGTTGAGCATATGGACGCATACGCTGATAGCATTACGCAAAAAAGCTAAAGCTATCCGTACGTCTTTG
TCTTTCTTTTGCAGCGTCTCCTGAAGCTTGCGTACCTGGGTCTTGAGCTGCAGAATGAGGTCGTCCTGGGATCACACACTCCAAAGTCAGCCATGTGCAT
TTAATAGGCATTAAATGGATACATATGATAGGCAGTAGCCCACTTTCTCCGCGATCTGCTTCTTTGCAACGCCTAGGTCTTCCTTCGTGCGCTCCCACTC
TCGACGCTGCTCTTCAACCTGATGAGCATGATTTGTCAGCAAGGCAAGAGAGAAGCCAGTAGCTACGTCATCATACAGCAAGCGAGAGCTACACGCACCA
GTATATGCTCGTACGCAGCAGCATTGGAGGGCTTTGCACCATGAACCACAGCGAACACGCCACCTCTGCCCATCAATCAATCAATCAAAGGCATGCACAC
CTCTAACTTTTGGCCAGCATGAGAAAGGCTCATTGGCGAGTTCGCGTCTTTTCAGGTACCCATTATGTGGGCCACCTCATGCGAGTCCATATAGAAATAA
AAAGTCAAAAGTCAACTTCTATTTCTAAAAATCATCCGCGAGAAGTCGCGTATCCATCAAAAAGTGGCGGATCCGAAATGCAGACAGAATCGCTTAGTGC
ACACAAGAAATAGCGCCAGCAGCAACAACAGCTCTACGGCCACCGCTTGTTGCAAACCCAGCAAAGCAGAGAGCAACAACACTATACTAGTAGCAGCGCG
ATGGGAGAAGCGCCGAGCTGGCAGCACATGTGGGGCGCCAAAGTCAAGATGCCGTGCGACATGGAGGACGACGTGCTGGAGGACGCCATCAAGCACGTGA
CCTCGCGCTTGTCCAAGTTCGACACGGAGGAGTGGGAGAAGCAGGGCCTGATGGTGCGTGCTTGTGTTGTTGGTTTGCTATTCCAGTGTGCTGGTGTTAG
TAGCATTTAGCCCAATGCGTTGGTTGATACTGTCGTAGGTCTGCGAGGAGATCAAGGCGCACATGGACGAGCGCTGGGAGCCGCACTGGGTGGTCTGCAT
CGGCCGCAACTTTGGCTCATATGTCACGCACGTCACGCGCAACTTTGTGTTCTTCTACTTCAACGAGAAGGCGATCATGGTCTACAAGGCAGGCTAAGTC
AACCGCCACTCACGCACAAAGCAGCTGCTATAGCGTTGTGTGCATTGCAGTCATTTCCAGCACAGTGCACGCGCGAACAGCTCACCGATAGCCAGTCCCT
GTACCATACATACACGTAGCTAAAACTAATCTGTACTGTTCAACCTCGTGGAACATACATGATCCATGCCACAGAGCACAGCGCTCATCCAGTGGCGCTC
ATGCTTGACCAGAGCAATAATAAAAAATATACCCCCAACTACAAAAATACATCATTTGCGCATTGCCAAATACAACCTCTTCAAATCATATACACGTCGG
CTTCTCACGGGAACGCGGATTTCTTCAGCCAAATAGGCCAGAGCTTTCGTTCTCCAGTCTGCTGAATTATTTGGCTCACAGAAATCCGCCGCATTCTCGT
GAGAAACCAACGTGGAAATGGTTTAAAGAGGGTATCTTATTTGGCGTCAGAAACTTAGCGTCAACCTTGCAGCCAGCCAACAGTTTTTTTGACACGCTTT
TGAGCTTTTGGCTCGAAGGGTTACCGACAAAGCAACCCGCGCGCGCATAAGACACAACAGATAGAGAAGCATGGCGCCCGCAGTGAAGAAGCAGCGCATG
ACCGGCGACGCCGTCGCGAACACGAAGCAGGAGGCGAACGGCAGCGCGTCCCCAGATCCAGAGCTTGTGCGCGATGAGAACGATGATGACGAGGACGACG
ATGACATGGAGGACGAGGAGTCGCCCATGTCCATCATCGCGCAGTTCCAGAGCGAAGATGTACGACGTGTGTTGCGCCTCGTTGTGATGGCGACGCGTAT
CAATCAACATGGCTGCTGACTGGCTGCCTTGCGAATGTGCTTGCTGTGGTTGATTCTCTTTGCTTCTGATATAGGGAACGAGCGTCGGTCCGCAGTTGGA
CATCCCGCTGAGCTCGAATGTGAACCAGATGGAAGTGCTCGTGAACGAGTTGCTGCAGGTGCGTTCGTGTTCCGAGTCACTGGCTTCTTTAATGTATGGT
GGTCAGACTCGCTGTTGTGTTATGTAGTGACACATTGATACTCATGCAACGCGCTTTTTGCACTCACTGTCATCATCAACAGAACGGCAAGAACAAAGTG
CCGTACTCGCTCTTTGTGGGCGAGACCGAGATCACGAAGTCGCTCCAGGCCACTGTGGAAGAATTGGTACGCTCGCTTCTGCTTGATAACTTGATAGCGG
AGCCTCATGCGCTCACATCGCTCGTATGCTTCTTGCCTGTGCGACGCTTATTCAACAGAAACTATCGACGGAAACGGCGCTGACAATCACGTTCCAGCCG
CTCGCGGTCTTCCGCGTGCGTCCCGTGACGCGCTGCAGCGACACGCTCCAGGGCCACTCGGAGGCCATTCTGCACGTGAGCTTTAGTCCGAACGGCAAGA
AGCTGGCGAGCGGCGGTGGCGACGCGACCGTGCGCTTCTGGGACACGAACACGTCGATGCCGAAGCACACGGGGCGCGGCCACAAGCACCACGTGCTCTG
CACGGCGTGGGCGCCGGATGGCGAGCGCTTCGCGTCTGCGGACCGCAACGGCGAGATCCGCATCTGGGACCCGAACACGGGTAAGCAGATCGGCCAGCCG
CTCAAGGGACACAAGCAGTGGGTGAACTCGCTCACGTGGGAGCCGATGCACCGCAACGCCAGCTGCGAGCAGTTTGCGAGCGCGTCCAAGGACGGCAGCA
TCAAGGTGTGGAACGCACGCACGGGTCGCCAGGTGGCGTCGCTCTCGGGCCACACGGACTCGGTCGAGTGCATCAAGTGGGGCGGCGAAGGACTCATGTA
CAGCGCGTCGCGCGACCGCACGATTAAGGTGTGGCAGATGGAGGGCGATCATGTGGGCAAGCTCGTGCGCACGCTAGTCGGCCACGGTCACCGCATCAAC
ACGCTGGCGCTTAACGTGGACTACGTGTGCCGCTCGGGTCCGTTCGATCACACGGGCAAGACGTTCGCGACGCGCGAAGAGATGCAGCAGGCAGCGCTCG
AGCGCTATCAGGCCGTGCGCAAGAGCCAGCCAGAGCGCTTGGTGTCCGGCTCGGATGATTTCACGCTCTTCTTCTGGGAGCCGGCGGAGAACAAGAAGCC
GATTGAGCGCCTGACGGGGCACGTGCAGCCCGTGAATCATCTCTGCTTCTCGCCGGACGGCCGCTACTTTGCGAGCGCGTCGTTCGACAAGAAGGTCAAG
ATCTGGAATGGCCAGACGGGCAAGTTCGTGGCGACGCTGAACGGCCACGTCGGCGCTGTGTACCAGGTGTGCTGGTCGAGCGACTCGCGCCTGATCGTGA
GCGCCAGCAAGGACTCGACCGTCAAGGTGTGGGAGCTCGCGGACCCGAAGAACGCCAAGATGACGCTCTCGGGCCACGAGGACGAGGTCTACGCGCTCGA
CTGGAGTCCGAACGGTGACAAAGTGGCGTCCGGCAGCAAAGACCGCAAGATCAAGATGTAAGTATCCTGGTGCTCATTTATTTGGTTGTTTTGTGTGTTT
GTGTGCTTATACGTACTTATCACTGATTGTATCTGGTGTCTGATTGTTGTGTTTGCAGCTGGTGTCATTAAGTTTATGAGTTCGACGACCTTCTCACAAC
ATTTATAGACTTTTGACTTCCTAAATAAAACCACGTCCTGCTCACTCGGACAACCTTCACGCGACTTCTTCGTCTGCATATTTCCTTACTTTGGATCAAT
TAAATCGATACCGGTTTAAGCTTGATAAGAATTTAAAGACTAAAATAAACAACACATTCGACTCCATCATTCCTTGCTGAGTTCCCGCCAAGCATACGAA
GCAAAAGCCCGCCAGTTTTCTTGTCAGTCTTCTTGTCAGCCAGAAGCAAACAGGTCGCCAAGAGCCAAGCAGGAAGAGATGAAGCGCGGACGCGAAGAAG
AGTGCAGCTACGCAGAGCAGGAGGTGCACCAGAGCAGAGCTGCTGACGCCACGTTCTCCCCCGTGCACCCGTCTTTCCACGTGCAGCATGGTGCCCCCAC
GTTCGGATCCATCTCGCCCTGGAAGCAGCAGTCGCTGGTCGGCATTTTCCAGCGCTTCGCCAAGCCAGTGCCGATGAAGCGGCTCCGAGACCGCTCTGTA
CCAATCGGTAAGCCTAAGGGACAGAAACATGAAGACAGGCTGGTTACGAATACTTGCGTTGTTGCCATCTTTCTTCTTTTTGGCTGACTGGATGCATTTC
ATTTGTTTTCTCGATGGTTGGTTGTAGACGCGATGAGCCGCATGATGTCGGCTGCAGTCACGAGTGCGAGGATGAAGAAGCACAGCGCGCAGATGCAGGC
GATGTCGATGCTCCCCGCGACTAATAGCGCGTGCTGCGTTGTGTGTGAGAGCGGAAAGAGGACCCTAGCCGCGCCGCCTGCGCTGGACCAGTGCTCGTAC
TGTGAGAAGCTCATGGGGGCGTGCTGCCGCCGCGAATGCGAAGGCTGCTTCAGCCAGTTCTGCTCGCTGTGCTCCACACTCAAGTACGTTTGGTTGTCAT
GTGTCATTCAGTGGGCTTGTGATGTGCCGCTGATTTGTTACTTACATGTCATGCTGCGTCTGCGCTTTTGAATTCCATATTTTGTAGCTGCGACCAGCAG
TTCGACCGCGTACTCTGCTGGACCTGTAACGATGCGAACATTTAGATGCATTTCGCTCTGTACATTCCCCCCCACACTACCACCACATTAATTTCTAACT
TAAATGTTGCGTTTTCTTTCATTGGTGTACCTCTTGGGAGCTCGACAATGTTGGGAATTGGCTGCGTCTTCTCTTTTCTCACCATGTCTGTTACCTCTAA
CTGAATGTGCTACCGGTGGTGACAGCGGTCGCGTCGTCACACAGGAAGCGTCGAACCATTTCGTGCGCGACATGCGGCTGATCGCGAGGCACCATCTACA
GGTTTTCGTGGCAGGAGACAGAGAGAAAGAATGACGTGAGCAACGATCCTACAACCAAGAATAACAGACACGCTCAAGAGTACTTACGTGGCCCGCCTCG
AAGACCTTCATGAAGCTCAAGCCGTTGGCACTGCGCACTTCCCCCGCTTGCTGCCCATTCAAGCTGAATGACGCCATTGGCGCATTGCTGAACGCCTGCT
GGTGAGGCCACTTCAGCTGGCGTGTCCACTCGTCCTGAGCCTTCCAGTTCACGACCGTGTCAGCGTCGCCTCCGTACACGAGCACGCGAACGCCTTGCTC
GAGAAGGTTCGCCACGTGGACTTCGCTTTCTTCCAAGTAGTCCCACTGCTCCAATTGCACTGTCAGATCGGTGCTGCAGAGCTGCCACGTGCGGTTGGGC
ACTCCAAAATACTCGAGCACTGGCTGCTGGTTGACAAAATCTTCGAGTCGGGAGAAACGGTAGCAGAGACCGACGCGGTCGTCCGCGTGACACTCGCGCC
GTATGTCGTACTCGTTCCAACCCGCACCAGTGACAGCAGAGACCACGAGCCCATTGAAGTGGTGGAAGAGGCTGACCGCATCGTCGCACTCGCTTGCTGA
AAAATCGTTGCGTAGCGATCGCTGACGATATGGGTTGTTAGCAAAAACGCACCGCTCAGACGCTGAGGCGAACTGCTCCGCCAAGATTCGGAGTTGCGCT
TCAATCGGCCCGAGGAGGTCCTTGTCGTACGTGTTCGAAGCTGCAAAATCCACAAACGAGTCCACCACCGACCTGGGGGAGACAACGCCATTCCCGATCC
CGACTCCCTTCAGGAAAGGACTCCACCGTGGCGCATCCGTTCTGAGCAAGTACTGCGCCAAGTCCGGGACATAGTGACCGCCGTAGCTTTCGCCAAAGAT
GTAGAAATCGTTGGTCGCGAGCTCCGGATGGCTGAGGAAGAACTGATCCAGAAACGCTGCCATGTCTTGCGCGGACTCCTCGTGGGTCCAGAAGTTGTCG
GCATCCGGATCGCTGAACCCCGTACCTCTCGGCTGGTCAAGGAAGATCACGTGAGCGAATGATGTCCACGAGTGGGGGTTGAACGAAATTCGGTTTGCTT
CGTCGTCGAAAATGCACGGACCGAGCTCGAAGAGCCCGCCGACAAGTCCTGAGCACCCAGGACCCCCTGAAAGCCACAGAATGACGGGGACATCGCTGGG
ATCAGCTCCAGACTTCGAGGATTCGTAGAAAATGTAGTACAGACCGCTCAAAAAGCCCGTCTCCTTCTTTGCTTGTTCTCCGCAGAGAGAAGTAGACGAC
AG