Description :
From Genome Similarity Track
Location :
Scaffold_22:613668- 614848
Sequence
1180 bases(100 bases per row)
GCTTCACCGCGAAGTTCTGGACGTCCCTCTTCAGAGTGCTTGGCACTCGGTTGGACATGTCCACAGCGGACCATCCGCAGACCGATGGTCAAACCGAACG
CGTGAATCGCGTTGTGGAGGATATCCTCCGAAGCGTATGCGCTGAGGCGCCAAAACGCTGGAGCCAGATGCTCCCACTCGTTGAGTTCGCATTAAATAAT
GCAGTGCACGCCTCGACAGGCTACACTCCGTTCTATGTGAACGGCTTGGTTAACCCTCGCGTCCCATTGACGCCGCCACGCAGTGGCTCAGGGCTTGATG
GGGGAGGGATAGCCGAGCGGCTAGCTGATGTCAGCCCTGTTGCGGTTCGCAAGGAAGTCGATGACTTTGTCTCTTTGAGACTAAGCGTAATGCGTCAAGT
ACGCGACGCTATGGCTGAAAGCCAAGACATGCAAAAAGAACATGCAGATGCCAAAGGCAGACGTAATGAAGAAAGGTTTGAGGTCGGAGACCTAGTTTTA
TTAAATGCCAAAAACCTACCTACTCATGCAGTGTCTGCAGTCTTTAAGACAAAATTGAGACCACGGTTCATAGGGCCGTTCAAGGTCGTGGCCAAGAAGG
GCCTAGCGTATACGCTTAACCTTCCGAAGAAGATGCGCACGCATCCAGTTTTCTACGTTGGCTTACTCAAGCCGTATCAGAACCCTGCTCAGGTGAGCGC
GGAGGCGTTGGCGCCAACGGTGGCTGGGCCACGACAGGCTGCGCAACAGCGGGAGGCCGAACCACGGCGGGCTGAGCGACAGCAGGTGGCGGGGCCACAA
GACGCAACAGCAAGTCGATCTGACCTTGCAGCTGAGCGACTTGACGCTCAAGGTCCGCGACTCGGTTCGGAACCGACTGTGGTTGTTCAAACCAGTCCAC
GCGGTGGTTCGTCTCATCGAGACCATCTGCAAGGCGACTCAGAGAGTCAGTCGTATCATGGAGATACCGGTTCAGGGAACCCACACGCTGCTCCAGCGCG
AACACGTCGCTGCGACTCGCGACGCGAGAGTCCAGCTGAGGCTCGGCCTCCTCCTGCTCTGCTCGATGAGCACGGCGAGCTCCACTTCCATGTGGAACGC
CTGATGGCGAGGCGCATGCGCCAGGGTCGTACTCAGTACCTTGTGAAATGGAGGGGTTATCCTCACTCACAAAACTCTTG