Description :
From Genome Similarity Track
Location :
Scaffold_22:6136- 7178
Transcript NameFunction/comments
Phyag_g621hypothetical protein PHYSODRAFT_473216

Sequence
1042 bases(100 bases per row)
CGTGCTCGCGTTCGCTACTGCTGTGGCCACCACAAACGCCGCTGCACCTGCCATCCCGACGGATCGTATGGCCCAGTTCCTCCAAGAAAAGGCTGTCCTC
GAGTCTGAGCTCAACGGGTGGAAGCAAAGTGACACTGGTCTGTTTGCAAAGGAGCATGGCTTCATCCCAGCTCCGTCCTCGAGGGATGCTGGCGCggctg
aagacgaggaacTCCGCCGTTTCTTCctgaccaagctgctgattgAAGAGGCCCAAGCTACAAACCCGGAGGCAACTTTCTCCACCGACACGCCGTTTTC
CCTGATGACGCAGGAGGAATTCATCAAGTTCGTCGGTGCGTCGTATCAACGCGGCTCGGGTCTGCTCGCTGATACCTCGTCGTCAATCGAGGTGTCCTCC
AACGCGACTGCCACTGATAAGGACTGGACTACGTCTGGATGCGTCGTTCCTGTCAAGAACCAAGGCCAATGTGGTTCGTGCTGGGCGTTCGCAGCCGTGG
CTTCCCTTGAGAGCGCCATCTGCCTTGCTGGACAACCGTTGACGTCTCTttcggagcagcagctactggaCTGTGACGAGACTGATCAGGCGTGCCAGGG
CGGGTTCCCCGGTGATGCTCTGACCTTCATCCAGAACGCCGGCGGCATCTGCACGGAGCAAGGCTACCCTTATGTATCGGGAGACACTGGCGACAACGAC
ACTTGCAAGACTTCTTCGTGCACCCCGGAAGCTGTGACGATCCGCAAGGTGGTGTCAGTCCCGGAAAGCGAGAGCGGTTTGATTGAAGCCATCAGCGGGC
GTCCTGTGGCTGTGGGGGTCGCGGCCGGCAACCCCACGTGGAAGCAATACAATGGCGGCGTGGTGTCTTCctgcacgacgacggagcTGGATCATGCCGT
ACTGGCCGTGGGCTACGGAGGCAGCGACACCTCGACACCTTtcttcaagatcaagaactCGTGGGGCACACAGTGGGGTGAGGCTGGCTACATCCGACTC
AAGCGCGGCGCTGGAACCGGCAGCTCTGGCACGTGCGGCATC