Description :
From Genome Similarity Track
Location :
Scaffold_134:6134- 8264
Transcript NameFunction/comments
Pytul_var.sporangiiferummaker-pug3_contig_134-snap-gene-0.19Mitochondrial Tricarboxylate Carrier (MTC) Family
Pytul_var.sporangiiferummaker-pug3_contig_134-snap-gene-0.20CDS Pa_7_4670

Sequence
2130 bases(100 bases per row)
ACTGAGCTCGGTCGCAAGACGCGGGTACTTTGCCTTGGGCATCAGCTTTGCCTTCTTCAGCCCTTCGTACAAGTACGGCGGGAGCAGCAAGACTGCGTAT
TACACAGCATTGGCGTGAGTCCACCGCAAGCAATACGCCAGGAAAATATAGACCACTTAGTAAACGTACTTGGCATCGGAAGCGCCACGCGCGTGAGCGC
CACTTGNNNNNNNNNNNNNNNNNNNNNNNNNNNNGACGACCTGCAGCGACCGATCGGCCGCGAACTTCGCCATCGTCATCGATGATATCAATGCCATCCC
TGCGTGGTACCAGCACGAGCAGCACCAAAATGTGAGTGGCCAGAAAGAAAAACAAGTTTCATAATTGCATCATGCAACAATGCTAATAACACGTACGTGA
ACTCGTTGAAGCGCATGGACACGGCGTTGAATGCACCTGCACTCGCGACGGCCACAAAGGGAACAGTCTACAAGATCACAATATCCGTAAGACGTCAGAT
AGCTGACAACAAGTTGCGCCTCATCTTCGCGGTTACCTTGCGAAGCGCTGAGCGCACGCCGGGAGAGAGCGACNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNGTCACACAGGAGACAAATGACGCCGTCGCATACGACTCTGCAAGCAAAACCAGTGGGCTCGAGCGTGATCAAGAGAG
CAGTTGATGGAGTTGAGCAGCACACACAACGTACTGAAGATGGTCGAGTTGTCTTGCTCGCTACTGGCGTTGCGGTTCGCATAGTTGAAGCCCGCGTTGT
AGCTTTGATTGATCCATTGCCAGAAAATTGTGTTTCCAAGCTGCAATCAACAGGAAAAGAGATTGACATTAGGAATCGACAGTCACTATATGGAAAAAAA
TAGCGCAATACGCACCGTCGGCGGCGCGAGGATCATGCCTGCGCAAATGGGAATGTTCACAGGCACGAACGCCGACAGTCGAAAGTACAGCGGCAACGTC
TCGCCAGTCTGCGGATGCACTGCCGACTCGTACACTGTGTGCATCAAACACACGGACCAGCACACACAAATTCCTTTGTAAATACCAAGACGTTCCAGTG
ATATGTGGTCACTGTACACGACTGACTCACGACACCATCGAGCAGTAAGCAAACCTCCTTACCTCGTCGCGCGTGCCACAGCTCTTCATCACGCATTTGA
CCGGGGGCGATGTCGCCATTCCGGTACTTTTCCAGGGTCGTCGTCGCGCTCTGGATCTGTTCCTTCGTCAAAAACAACGCGCTGTCCACCACATCAGCAC
ACACGTACACACATGCACACAGGCCAATCGCTCTCACCATTAGACCCACATGCCTACACATACCATGCGCTCTATGCTAGCGTATGCATACATACCTGGG
CGACACGAGCTCGACGAATTGGCGCCAGCGGCCGTAGTACGTCGACTGGTCGTACTTTGGCGCATCTGATAGTCCACACACACGCACATCAGATCCACAC
ATAAAGGGACAGAGGTACATCCACTGCACGCACGCGCACATACCGATGGTGAAGGGCGGGACGGCGGCCATGGCGGCGGCGCGACAGAAGACAAGAGCGG
AGCTCTCTTCTCCTTCCAACAGCAGCAGCAGCCAAATGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNAACTTCAAACGATTCTAATCATCG
CATCTGACGAGTAGGTAGTTAATGAGTCGTGTACGGTACTTTGTTTTCATGTGACCCACATAAAATGAACCCATTATGCGACGTTGGACATCTTTCGCAA
ATGTATGTGGTGATCTAGTACATTATTTAATCTTATGGACAGCTTAGGTTAAACGACGGAGCGCGATGGGCGGAAGCAGCTACGCAAGTGCCCTTTACTG
CTGCTTAGTCTCGCTGCAGCGTGAAGCCCTTGCCGAGTTCGATCTGCTTGAGCTCGGCGAGCACCTGGTCTCCCGCGNNNNNNNNNNNNNNNNNNNNNNN
NNNNTGGGTACTTGGCCGTGGACTCTGGGCTCGCAAAGTGGCCCAGCGGCTCGAGCGTCGNNNNNNNNNNTGCGAGAACAAGGTCGACGACACGCGCCAG
AGGCTCTTGCCGGCCGCCTTACGGGCCTCG