Description :
From Genome Similarity Track
Location :
Scaffold_1553:6133- 7602
Transcript NameFunction/comments
Phypl_g13695phospholipase D, Pi-sPLD-like-10
Phypl_g13696conserved hypothetical protein

Sequence
1469 bases(100 bases per row)
GCAGTATGACATCCGACTCGGAGCTCAACGCGAACgtgatcgacgacgagaccgTCGAGTCTCCGGACGGTATCACAGTGCTCAAGCTGGCCCGGGACAT
GCGAATTCGCAAGTTTGTCGAAATGACCGGGCTGAGTTACAAGAAACTGAACGCGATGAAGTTCATTGATGCGGCAGACACGTTCAAGGTGGCTGCAAAG
GACGAGTCGACGATCCTAACGGACTTTAGCGTCTCGTACAGTCTCTACTACGAAGCGTTCGTCAGCAAGTTCCGTGAGCAGGTTGACCCCCAAGAagtgt
gcagcttctcggacTCTGGTTCCACGAGGGATCTCCAATAGAGTAGAGTGTTTAAACTTGTGAGAGCGAGTGATAGTTCTTTTGGAGGGAGCAGCGACTT
GTAGAGTTAATTATCTGGTCCAATCTACCATTCGAATGACCAGCCTCTGCTCAGGGGTACTGAGTGAATTCTCACGGAGCAGGAGATCACCGACTCACGC
GTCTCGAAACGATATCTCACTGTTCAACTTCGACGCAGTCTGCAACGACCTGTCAGTAGCAGGAGCGGGTGACCGCGTTAGGCTGGAGGCTTGGGATTCC
ATGTTCGATCTGCAAAGGGTTAAGCTAGGCGAGTGATCCCGAGGCTGCAGAAAGCGAACGTCGTGGTCAGATCAAGCCCCCACCGGCTAATGCGACGTCA
GCTTACTTGTACGAGATGATGCCGAACAAGTACTCGAACATCGTGGACGACTACGCAATTGAATCCCCGACGACATCACGGTGAACAAACTCGCCCGCAA
CGTCTGTACCCGCTCGTTCTACGAGATGACGGGGGCGTCACCTGCACCTGAATAGGCCATCTACACATCCGTACACTAAGCCACAGCGGTTAAAGCCGAC
AGAATCGTCGCCCGGCAATTCAGCATCAGAGGTTCGCAACGCGTTCTCTCTCTTCTCCTGTGCAACATGGAATTCCATTGTGCCGACCCTGCTACGGTAA
TCTAAAACTGTCAGCAGTCAAGTCCAgagctcggcgtcctctCCTTAgacctgcagctggtccagcagcgcgttgtaCTCGACGCACTTCTCGGACAGCA
CAAGGATTATCTGCTGGTACGtgaccagcaccttctcgacTCTGGAGTGGAGCGCCagagctcgctcgctctgcagctcgctctgggcttcaagctgcgt
cAGCTGCGCCTCCTGGCGGGCCTCGGGCGCTCGTAGCTGGTCCAGGACGCGcgccaactgctgcagctgctgcaactgggccgcgacctgctgcagacgg
TCCGCCGAGCTCAGAATGGCcgcgcgcttgagctcgtcgccggctctggagctgctgtgggCGAAGGCGCTCGCAGacgtgagctgcagctgcccgGCGT
GCTCCTGGTCTGCAGGAGAAGGGGGAGAGACGTTAGGGATTCTTTAACTTTATACGACGTGGAGGCAAG