Description :
From Genome Similarity Track
Location :
Scaffold_389:6133- 7524
Sequence
1391 bases(100 bases per row)
CATCACCTTCACTGAAGTGATGCGAGCGTTCACGGTGCGCAACTTCACGGAGCCTGTGTTCGTGGGGATCTTCGCGAACAAGTACATGTGGTTTGCGGCC
GTGCTCTCCGTGTGCCTGACCATCCTAGTTACCAACACACCCGCAGTCATGGACGACATTTTCGGGTTCGCCTACATCCCGTGGTTCCAGTGGCTGGTGT
CGTGCATTGGAGCAGTGAACGCGGCCTTCTGGGGGGAGATCCTCAAGATGTTCATTCGGCGACGAGACCGCGAGCGAGCGCGCTGGGAAGAAATGCGCGA
GGGGTTTGAGGCGGTGCTTCTGGAAATCCGCCATGTGCGCCACCACGTCGAGAGACTCGAGAAGTAAATCATGAGAGCATTGGTACCTAAGCTTATTGGA
CACCGTCAGCAAAGTGTTTGGGTTGGTTGTTCCTCGTTGACTTGGAGCGCTTCAATATCTCACCATCTTTCGGATGTCTGTTGGCACTTTTCTCCAGGAC
AGGTGCCATTCCCTATTTCGCCGCAAGACCACCAAGTAGACCATCCGATGGCTGTCAAGGGTCGGAAGTGGACGACTCTGCTAGTTGCTACATTCGTCGC
TATTGCAGATGCCGATACCGACGTCCCCAACTGGGTGAGCCCGATCAATGTGACAGATTCCGCCTGCTACCGCAAGACGTACCTGTCTTCGGAGACCTGC
GCCATAGGCTACGAGTCTGATGGAATTGCATCATGCTGGGCGCAGTGCCCTTTGAACTTTCCTGTTGAGTGCGGCGCGGAGTGTATTCCACAGAGTTCGG
ACTGCACTTCCGAGGTCCTGGACAAGGTCACGTCGGTTGCTACGGTGGCACTTAATGCCGCTACGGCTGGCGTCTTCGGCGAGTTCATCAAGGCCAGTAA
AGCCCTGCAGCTCGGTGTCAAGTGCGGCCAGTCGCTCTTCGCAGCCACAAGCTCCCTTGTGAGCTATGTGGACGAGCTCCAGGCTAACGCAACGCAAAGC
GAGCAGCTACTGAGCGTGGTGAACCAGTCAGATCTCGTCATCAACGAGCTGCCTGCGGCTGTCTGCACGTGCCTCGGACTCCCGGTGTCTACTGACACGT
TGGAGCTCAGTGCTGACGTGGTTGCTGCCGTCAACCAGATTGTTACGGAGGTGGTTGAGAATGGAGCATCGCTGCTTGACCCCAGTACGTTCTTGGCGCT
CATGAGCGACATTGGCGTTGACGACTCTGTTCAAGACCTCGACACGGACAGCGTCGCCCAGCTCCAAGACGTTCTAACGGCGGGCACAACGTGCGGCACC
AAGCTGCAGACGATTATCCACAAGGTGACGCAGTTCGTGGCTGGTATCAAGACCAAGGACCCCAGTAGCACCGTCAGCAATATCCGAGAGG