Description :
From Genome Similarity Track
Location :
Scaffold_26:613111- 615539
Transcript NameFunction/comments
Phyca_LT1534507287alkaline phytoceramidase (aPHC), putative
Phyca_LT1534547802Mitochondrial Carrier (MC) Family putative

Sequence
2428 bases(100 bases per row)
ggcagtagtggtaatccaggagccagaaaccaaagccgatgagtgccgacgtcacgtacgacctggccactgcacgagccctcgagtccttcacctcggc
gtagtgcatgcacagacgcgcgcacgtgagcacggcgagaagaccgaagaagacttggaagacggttgtgaaccggtagatggcgtggatggcagtgaac
acggcgccgatagttgtcaagaagacgatggcgtaactgctagcattctttacgggtagctcctgaatctcgttgttgtatacgatgtaaatccacacga
gcatggcccacaccattggtgtctcgtcgcattgctgataaacgtattgcagcgtgccgtggaacattgctgacccgaagcctgtgaccattacgccgat
gaactgcaagtggaagcgaggctcaaagcccagcttaatggatcggtacagaccataaagacccagcaagacgaagagcgagttgctgatagtgttccaa
aactcggcgatgtagtagctgtgctcgtagttgatttcgcaccagtcgatggtggacgtaggaggcccccagaagcccacgggcgctgacgtacgcatgc
tcgagtgctcaacagtggtcatgacttggtcttcttgtgtccaaagcgcgaatgaaagggagttcacctacgagtcgtaggctacgacacgcttccttca
gttctgacggtggtgttcaaatgccgcaatcacctgaaccaattgcatagaaaactcaagaaaggtgagtttgagcctgcgacattgccaagagattgcg
ctccaccgcagttagcattgctgccgtccatcaacagactgagttggcaaaggtgacagagtggagagaagtccatttggagttcggtagcgctgccttc
atctccccgcagtcaatgaggcaattaaacgtctcacgtggtgaagagactcttgggttgcaaaacgacaggtgagcgggccgtatcatgccgcatgatt
catgcaatgctatcatctttcagcttttcatagcttcttcaattctctcctggcaaaaagtatctttgcaaccacacactctcgctagtcggtgcgtgcg
tcgtcgacctatgttgcggttggttgtttactccactccgacgcactgcaatgtgcttcaacccgcatggattcaagcgagagctgctgtaattcagtga
cgcgaaattactcgttactttgtttacgatgctcgtcaccgcaattgaaacaagacgcttgagtgattctcgtcttcatcaggctgttacatgtagtgat
gtaattcttgagtgtacatgtacatcatgacctatgcagctctcattgagactctcagtctgtttggtttgtggctgcttgaacccagcatctttcgtgc
aacctacttgcttcaatttgattggctgaaaagacacccgcaatcaacgtgtgccgtttcaaagtcaaattcccttcatcatggcgctgagtaaaccgat
ggaaatggtggccgcggccaccgctgcaggcgttgggggcttcttgtcgacgtcaattctgtaccctctggacacgttcaagacgcgcatccagtcgggc
gcatcgctactccccgaggacgacgacccgagcgtcccgaagaagaacaagcaactggcgctcattaaatcactgtaccagggtatccagtacaaggcgg
cggagtcgtccacctccaagttcctgtacttttacgcgtacacgatgctagctcaaatggtggcaccaaaagacggtaaacccatcggtactatcacgga
tctaggcattgggtatctgagtgaactgtgccacctccccatcacgatgccgatggaactcgtgggcactaggatgcagactggctcagagtctggcagc
attctggagatcctccgctctattgtcaaggagagtggagtcgggggactctacaaaggactgggagcatactttgtgctgtgtttgcagccagcaattc
agtacacggtcttcgagcgactcaaggggatgtacctgcgcaaatttaaacaggcgtcacaggcactcggtgctctggaggtgagggacgaccgtagatt
gacgggtagcgtggatattgaccgttgcgtgttttattttgttgtaggcatttgtgctaggagctattgcacgatccatcgcgacattggtgctgttccc
gtacatccgtgccaaggtgctgatgcaggctaacaagaagaagcagacagcagaaggccagttggacaatgccgagcctaagaaggataccatcgcgtcg
acactgcaacgtgtgtacacggaggaaggtgcactggcgctctaccgcggtctcgggccggaactcacgagggtacgctatgctattgccttgatctaag
caaattggtgttaatgtagttgttgctg