Description :
From Genome Similarity Track
Location :
Scaffold_783:6131- 7964
Transcript NameFunction/comments
Phyag_g80043-ketodihydrosphingosine reductase, putative
Phyag_g8005hypothetical protein

Sequence
1833 bases(100 bases per row)
TCAAGTCGTGCGACGTTGCGGACTTCGCCAGCGTCcaggaggcggtggacgcTGCCAACAAGTTCCACGGCCGTGTTACGGACCATGTGGTGTGTTCGGC
GGGCTTTGCTTTCCCCGGCTACTTCATGGAGCAGGACGTGAGTCTgtacaagaagatcatggacGTCAACTACTTCGGCACGCTGCACACCATCAAGGCG
GCGCTGCCGGCGATGGTCCAGCGCTCggaggaaggaggagagGGCGGCCACGTTGTGCTGGTGGGCTCTGGGCTCAGTCTCATCTCGTGGATTGGCTACG
CGCAGTACGCTGCGCCCAAGTACGCACTGCGTGGACtggccgagtcgctgcgTAACGAGCTTAAGCTGTTCGGTATTCGTGTGAGCATCTTCTACCCGGG
CAATATCGACTCGCCCGGTTTTGTGGAGGAGAACCGCACCAAGCCGCCGGAGACCAAGACGATCGAGGGAGTGAGCGAGCCGCTGCACCCGGACAAGGTG
GCGCAGTCGCTGATCAACGGCATTAGTGATGGCCAGTTCAGCATCACGAACGATCCCATGATCTTCATCCTGCGCGTGCTGGCGAACGGTGTTGCACCGC
GCTACAACacgatgctggagaccgtgatgctgccgctgatCATTCCGATTCAGGTAGGAttcggcttcttcatggaCTTCATCGTGTGGCAGACGAAGCG
TGCccgcgagaagaaggcgaaggacCAGTAAGATTTCGGTGAGGAGGGCAAACAGGAAAGGTAATGAGAAGTGAAGACATCTCTCTCTGAAAATACGCGT
TCTTTCTACTTCACTGCGGCTTCGCTCTATGAAAAAGTAGTCGGCACAGGTACTGGTGAGCTTATCCCCTGCGCTTGCTGAGACGCCAAGCATCAGGCGG
GTTGAAGCGGTCAAATAGCggctcgatcttctcgttaCGCTTGCGCTTCGAGAGCTTGGTGGGGTCACCCTTCTTGAAGAAGGCCGGGGCAAGTTCCACA
AGCCACTTCGGCTCAATCGTCATGATGTTGCGCATGTACTCCTTCGTAGTGAGCACAAGCTCATGGTACAGCACCCACTCGGGACTCTTGTTGAACAGCG
CACTCGACGGATGAATGTACACGGGCTGGCCCTCGACCATGGTGCGGTATCCCTCTTGCGGGTCCTTTTTAGCCGTGTTGGCGAAGTATCCTGCAACAAT
TGCACGCCGGACTTTGTTGAAGTTCTTGCCGCAGGAAACCACGTCCATTTTGTACCGGTCCAAAATGGACAGCAACTGTTTCCGCACGTCTTGTGCTCGT
CGGATAGCACGCGCTTGAATGAAGTTCTCATAGCACCACGGGTTCGAGAATTTCGAGTTCGCCCAAGCCTCATACACCGCAAGCAATGTTAAATGGTCGC
CTTCAGGCTGGTGGAACTTTGCCTTCTTCTGGTCTGCCTGCGCCTGTTTCTCTTTTGGCCGGAAAAATACCGACTCAACGGACAGCATCGCCACGATGGT
CAACACTTCCTCCGCACAATCAAGCACAACAGAAGTCAACAGCACCTTGGCATTCTTGGGCTCTACTGGGAACTCGGCCATCTTCTTTCCTAGTCGCGTC
AATAACCCTTCGTCATCTAGCGCACCCAGAGCGTACAAATTCTCCAGTGCCATGACGAGAGCATCTTGTGGCGGTGGGTCCATGAAGTCGAACCCCATAA
GATCATTAATGCCCATTGCCTTCAATTGCAGCACAACAGAGCCGAGGTTCGCACGTTGAATCTCAGGCACAGTTGTCGGTAGCATCTCGTTCTTGTACGC
ATTTTCTGTGTACAATCGGTAGCATTTACCGGG