Description :
From Genome Similarity Track
Location :
scaffold_43:61306- 62983
Transcript NameFunction/comments
Plaha_PHALS_03322hypothetical protein

Sequence
1677 bases(100 bases per row)
ATTTTTCCTGTAAAGTTAGAATTTCTTGTAGCATGAATGTCACATCTAAATCAGTGAGGGAGAGATCAACCCCATCATACGTTTGGCGAAGAGACTGCAA
TTTCATCACGTACTTCATCAAGTGCTGACTGCGCTGGTAGTGGGCATCGACGTGCTTAAGAATCTCAATGCTCTTCTCCATTGCTTGCTGACTTTCCTTT
ACATAAGCCAAAACGGTTGAGCCCTGAGATGCAGCAGCTTTTTTCAGAAGTATCGTTGCTTGTCTGAATTTTAGTCGAGCCAATAGTTGAACAAACGCAG
CATCAAATTCATCATATGTCACTTCATCCCTGTACGTCTGTGTCTGATTTGGTgtagtcaaagcttcaataGCTCGTTTTTCTGCATCTAAGAGAGCACT
CAATGCTTTGTCGAGGTCGGGGTTTAGCTTGCAGTAGCGCAGTGTCCACTTCAGAAAGCAAGACATTTCTAGCTGCGAAGTCTTCAGTGAACTCTCTACT
TGAGCTAATGCTTGTTCATTTCGACCTTCAATCTCCAAAAACAAGCTAGATAAATATTTATACTTGCAATTCAAAAGGTTCGGGACATCACTGCAGTACT
GTGTCGAAAATCGCAATATCTCAAAAAGAGACTTTGCCTGATGATGAAACCCGAATCGCAACAAGAGCTTTATCGACTGGAATGTTTTCAGCAGTGGATC
AACGAGAGAGCTGCGAAGGATACACCGCCTTCGCAAACCAATGTCATCCCCCGACTTTTCAATAAATTGCTGTGCGCTTTGCAAATCTATAATTAATGAA
TCATGATGACCTTGAAGCATGTCGAGCGCATTTTGAAGCGGTATCAAATAGTTACTTAAGTTTAAGTGCTCCATGATGCTAAATTGAATGAGTTCCATCC
ATATGTGCGCACTGACAGATCGTTGAGGAACATACGTATGAAACACCATGATGTACAAGCAAAGTGGAGGGATCATGCTTGAGTATTGAAGACCATCTTT
GCGCAGCATTACAAGAAGCCTCTCAAGATATGTTAAAGTTAAAACTGGCTGCGTAATGTGAACTAACTTTGATACTTGTACGATGTTCCACGGCATGTAA
AATCGATTTGATGCATTCTCGTCGAAACttgtaaaaaaatcaatcCAATCTCGTCTCGTGGTAGGTTTTATATATTTTGGCAATTTGTGCAATCTCCATT
CATCAAAACTAATTCGATTCTCTTGCGCAAGATTGTCTCGCTCATATGCAGCACGAAAGTCATTATCATTTGTCGTGTCGATGATATATCCCCACGCGCT
TTCCACCTCATTGAGCGCCAATCGCATGTGCTCTGATCGTTTGGTACAATTGACGGAAATAATCGCACGCATCATAGAAATCCGAAATTGCTTTTCAGCA
AACCAAAGTGGAGAGTATGCAGCGTTTGggttttcttgatttgagaTTGAGAGCTGATTGGAATTTTCTTGCATTGTTTCTGTTTCGAGCATTTCCTTTT
GACATTGAAGTAACATTGATGAGGCAAACTCTAAAGATGAGTCAGTATCCTTTACGGCATGCTGGTTGGTGAAAAGCAACTCTGCAAGATCAAGAAGAAC
TAGCGCTTGTTGTTCTGTTTGTCCTTCAAATTCTATGTAAGTCTGTGATAGGGCCTTGAATTGGGCAGGAGGATTTT