Description :
From Genome Similarity Track
Location :
Scaffold_432:6130- 7708
Transcript NameFunction/comments
Phyke_g9447hypothetical protein PHYSODRAFT_507393

Sequence
1578 bases(100 bases per row)
CCCGGAGACGACATTGAAGGCGGAGCTCTACGTGCTGGAGGTGCCATCAACGTTTGGAGCCGCGATTACATTGGCATCGTCGTTCAGTATGCGGCTGTTG
GCATGATCTACGGCACACTGCCCGGCACTGTTTACCCCTTCCTGTTTAATTACCTCAACATGGAGAGCACCCAAGCCGTGTCCGCCACCGTGCTGCTCAA
CTTGCCGTGGTCGTTCAAGCTCTTTTACGGAATCATCACGGACTGCCTGCCCATCATGGGATATCGCCGACGTCCGTTCATGATCATCGGCTGGACGCTG
TGCTTCATTATGCTGCTTATCATGGCTTGCATGAAGGCTGGAGATCCGTACTACCCGGAATATGCTTATGCCTCGATGGACATAACCACATTGTCACCTG
AAATCGTCGCTACTTTCAACACGGACGCCCCCTCCACTGGCAGCAAGTTCATTGTCCTTATGATGATTGCAGCCGTAGGCTACGTTGGCgctgatgtggc
tgctgacgCCATGATGGTTGAAGTGGCCCAACGTGAACCTGAGGCTACGCGCGGGTACACGCAGACGACAATCTACATGGTCCGCACCGTGTTCGTGACC
ATCTCGAGCATTCTTACCGGCTTCGCCTTCAACGGCACCCACTACGGAGgcgacttcgacttctctCTGAGTTTCCCACAGCTCATGCTTATTCTCACCA
TCGCTTGCTTACCTGTGATGCCTCTGACGTGGTTTTTCATCAAGGAAGAGAAGCATGAGGGTATCGTGTTCAACAAGTATATGCAGGATCTATGGGCACT
TGTGCAGACACGCCCTGTGTACCAGGTCATCGCGTACAAATTCTTCTCCGGCATTTTCGAGAACTTCACCATCACGTCTTCCTCGGCCATGCAGGCGTAT
TGGGCTGGTGTGACGCCTCTGAACGAAAAGATCCTGGCCATCATTGGCAATAgcatcttcgccatcacGCTTTACTTCACGGGCAAGTATGGTCTGCACT
GGAACTGGCGATGGATGCACGCCACTATGATCATTGCGGTGACTGTACTGGATTGCCTCGTCACGATGCTAACGACCTGGGATGTGATCCGCAACCAGTG
GTTCTGGCTCGGCGTGCCTGTCGTTGAGAACCTCCCAACTGGTATGGCTTTCGTCATCGGCACGTATGTGATTGTGGAGCTCGCCGAGGAAGGCAACGAA
GGTGCCGTGTATGGTCTCATTGGCTCGGTGTCCAACCTCGCCACGCCatttgccagcaccatcaccaagAACGTGGACAGCAACTTCGACGTGACAAACG
CTGATATTGCCACTGACACGAACCATGTGCGCTGGGAAGTGACGTACATCCTCATCATCCGTTACTCCATGAACCTGGCAggtttgctcttcttgccgcT
GCTCCCCAAACAGAAGGCGGAGACCAACGAGCTCAAGAGAAACGGAGGTTCCAGCCGCATCTTGGGTTTCGTGACTCTGGCCTACTTTGCCTTTGCCCTC
GTGTGGTCCACCATGGTCAACATCATGTCCATCTACCCGTCCACCTCGTGTCTGCGCATCGCTGGTGGAACCGGTTGC