Description :
From Genome Similarity Track
Location :
Scaffold_517:613- 4996
Transcript NameFunction/comments
Pytar_ATCC12531maker-par_contig_517-snap-gene-0.4Conserved gene of unknown function
Pytar_ATCC12531snap_masked-par_contig_517-abinit-gene-0.11ATP-binding Cassette (ABC) Superfamily

Sequence
4383 bases(100 bases per row)
GATGCGGCGATAGATGCGGAGAAGGCGTTGGCGCAAGTGCGCGCATTCTACACACGCGCTGCGACCTACGGCGACGCCGTGGTGCTTGCGCTTGGCCTCC
CGTCGCCCACGGAACCGTCGAGCGCGTTCACCGAATCGGTCGTCGCGTTCGCCAAGAACCTTCACGACGAGATTAGCGCCCCGTCGTGGTTAGACCAGCG
ACATGAATCTGGTCGTCCCAAAGCGCCTCCAATGTGGTTAGTCCCCATGACGTTTTGGGGTCAGTTCGTTCCGGCTCTCAACGCCATCGTCTCGACGGCC
GCCACGCAGGTTCCGGACGCGACCCACATTCTCTTCCAGTCTCTGGAAATCCAGGTGCCCGAGTCCGGAGTCGCGCACTTAAGGCACCAGTTTCTGGACG
GATCAGATCTGGTCATCGGCGCCGCGCTCCCTGGCCACGCGTTCGCGCCGCACGAGCCGCAGCCGCTGCCGCTCGANNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNGTCACCACGCCCTGGAACACGCTCGCGCTCTGGGACTTACGGCAGCTCGCCAAGATCGGCTTCCCGCTCGTCGGGGACGGGCTGGGGCTG
CCCGTCGGCACTGCCGGCGTCGAAGAGGTCTCGACCATCGCATTGTACCAGCAGCTCTATCCAGCGCGATCGAAGGCCAAGGTCGTGGAAGTGCCCGGCC
TCGCGTGGCACGTCGAGGACTTTGCCGACGAGCAGCGGCGCGCGTGGCAGCAGCGCAAGATGGACAGTAAAAAGGCACGTCCGGCGCAGCAGCTCGCGCA
CTTGCAATTTGCCTCACCAAGCGGAGAGGTCTACCATGTAGCCACTTTGGATTAAGGTATTAATTCTTCCGTCGCTATACTTGTTCTTCGTCTTGCTCGN
NNNNNNNNNCTTGCCTCGCCAGGCGGAGAGGTCTACCATGTAGCTACTGTGGATATAGAGAACTGAATTGCCTAGCTAGAATTCACTCTACTTGTTCTTC
GTCTTGCTCGCGCGCAAAGCCGTTGAAGATTTGCTCGAGACTCGTCTGTGCGATCGCGTATTCCTTGATGCTCAGCGCATGACGCGCGTCCTCAATCAGA
CGAAACATTCGCGCGAGAGCAAACGGCTTGCCCGAGTCCAGTGTCTCCGTAGCTACTGGCGCGTGAGACGAGGCGGCCGACGGTGTGAGCTTGAACCGAC
AAAAGTCGCGTTGCCGCTCCACCAGCACGACACTGCCAAACGCGCCAAAGTGGGTTTGCAGAAACCCCGCGAGCGACGCCACGCGGTCTTCCAGGATCCA
CCATGCACCCAGCGCGTGGGCGTCGACTGGTCCACTCGTGGTGCGCTGGAGCTGTTCGCACAGTGCGGATCCCTTTGGGCGAGAGGGAGTGACGCCATCC
GGGAGAATCCAGAACTCGCGCTCTGGGCGACCCAGCGCAGCACACACCGCAGCGAGGCTCGTACTGGCGACCTGTCTTTCCTGAACCAATCCTCGAGACG
TGAGGTCCTGGACGAGATCTTCGACCATCGCACTCGTCGCCGTCTCGAGCTTGCACTCGAGCAAGAAGCCGTCGCCAAAGCGGGCTTTCAAGTGCGGGAT
CGAGCCAAAGCACTGCAGCCGGCCGCCGACCATGATGCCCGCTTTGTTACACAGCGCCTCGCACTCTTCCATGGCGTGGGTCGTCAGCACGACTGTCGAC
GTGCGCGACTGCACTGAGACGCGCAAGACGATATCCCATAGAAACCGCCTCGCCACGGGATCCATGCCCGTCGACGGTTCGTCCAGAAAGAGCAGCGCCG
GCTCGCCCAGCATCGCGAGCGCGACCGAGAGCTTGCGCTTGTTGCCACCACTCAGTGAGCCGGCGAGCTTGTGCTCAAACGCCTGCAGCTGAAACTGCTC
GAGCTGACGGCGGACGATGCCCTCGAGATCGTGGCCGCTGAATCCTTTCAGTCGGCCATAAAGCTCCAAGTGTTCCCGAACCGTGAGCAGTTCGAGCAGC
GCGTCAAACTGGGGGCAGTACCCCACGCTCTGCCGCACACGGGCCCGCTCGCGAAGAATGTCAAAGCCATTGAGAGACGCCGAGCCCCACGTCGGCTCCA
AATCGCCCGTGAGGATCTTGAGCGTCGTGGTCTTGCCAGCGCCGTTGATCCCCAAGAAGCCAAAGCAGTCGCCGCGCGCGAGACCAAACGTGAGGTTCGA
GAGGGCCTGCTTGCCGTTAGCGTACGTCTTGGAGAGCTGCGTGACGCGGACGACGTCATCGTCCTCCGCAGAGCGATTCAGAACGCGGTGTCTCTCGGCA
CAGACGTCCTCGTCTTCGACCAGGGGCGAGGCCTCCACCACCGCATCCTGGCGTTTCTGCCCCTTCCACCAGCGCTCGGCCATCAGCACACGCACGTCTC
GCCCACAAAAGGTGAGCTCTCCAGTCTTGACCATATCCACGAGCAGTGCGAGGACGAAAAACACGGGCCCTTGTACGGCCAAGTACGCCATCTCGTAGCC
GGCAATGCTCGTGGAGAAGGCACTGAGCGGCTCGCTGTTGAAGCCGAAGAGCGCCTCCAAATCGGCGATGATCACGCGCAGCAATCCGTTCGCGAGCGAG
AAAAGCGGCGAGCACCGCCAGAGATAGACGAGCACTTGGTTGGCCTCCCTGGTCGAATCGAGCGAGTCAAGCGAGTAGCTCGTCAGGAGAAGCACCAGTC
CAAAGAGGAAGTTCAGCATGACTGTGTAGAGCAGACACGCGCCGGGATCGCGCATGACGTGGGACATGAGATACGTCCACGGCGCGATCGCCGTGCCAAA
CAGCGCAAACAGAGCTACGACGGCTTGTGGTACATCCCGTGTGCACGCCGTACACGTCTCCGCGCCGGCGTTCGAGCCGCTGAGCGAGGACGAGACGTTG
TAGAACCGGAGAAGGAGAACGGCCACGACCATGGGGACGAGATAGAGCACGAGATCAAAGAGCAGATTCGCGAGCCAGTAGGCTGGCAGCGACACGCCGG
AGAGCAGTTGCTGGTGGCGCGCGTTGGCGCCGTCGTGCTTTTCCTTGACGAGGAACGGCATCATGGCCGCCGGGATGAACGTGAAAGCGATGAGCACGAA
AATGACGGCCGGGAGACTGAGAAGCGAGCCGAAAATGGACCGTGACTTGAACGAAAGAGGGAACGGGTGGGTCGCCACGCGGATCCGCTTGAAGGGTGGC
GAGGGTCGAGACCCGTTGGCCAAGAGGAGATTGTGGATGGCCTGGTCGGCCATGGCCTTGTAGGTCGGCGCGCCGTGGGTGGACGAGGAGTTGACCATGA
TGTTGTAGGCCAAGACACGAGTGTCTGCCGTGGCCTGCAAGACAAGGCCACCGTACTGACCGGGAATGGGAGGCTGCTGTGGTGAGAAAGGCGCCATGAA
TTCCGAGTCTCTGGCGTAGCCGCGTTCGAACGCGAGCTGAGCGTACCGTAGGCTGTATCCGGTCGTATCATTCGGCTGAATGACCGGCGAGGTGTACGAG
AGATTGAAGACTGTCGGGGAGACTGAGCCATTGAAGACGATCGGCTCGATTTGGACCAGCGAGGGAACGGCGTCTGGAAACAGCGACAGCGTCGCCTCAC
ACCAGTCGTCGTTGGAATCGCTGCTGCCTCTTGCTCCCCCAGCGTGAACACAGGCAACGGGCAGCGGCGTCTGCGAGCCGAGAGCGTACTGGCCCACCGT
CGTGAGCTGGACGCTCGGGTCGTTCTTGATCAAAAGGCTGAGCCGCAAGGCCGAGAGCCCCGCCAAGAGGATGACAATGGGCAGCAGCGTACTGTAGAAA
AGCATGCCGCGGTCGCGTTGCGCACTCTGGAATCGCTTCAGTAGTAGCGCACGCACTTGAATGAGAAACCACATGATACGTCCGTGGGGTTCTCTCATCC
GCACCGACGTATCTGCTTCTCTCGGCGCCGTGGGATCATCTCTCACCATCGAATGCATCTTTCGCTCCATCGCAATGGACGAGGACGGCATGGCGNNNNN
NNNNNTGGCGACGTGGGGTCGTCTCTCACCATCGACTGCATCTTTCGCTCCATCGTAATGGACGAGGACGGCATGGCGACGTGCCTTGACTCCCCATTGG
GGCTGTGGCCGTGCGGAAACTCGGCGACCTTGAGAAATATCTCTTCCAGCGTCGTCACGCTGATCGCGTAGCTGGTAATACCCCACTCGTGCTTGCACGC
ATCAATTGCGTCAAACAAGGCGGGGAACTTGGCCGACGCTTCAAAGGGCANNNNNNNNNNGCTTGGCTCCGCAATGGGGCTGTGGCCGTGCGGAGACTCG
GCGACCTTTAGAAAAATCTCTTCCAACGTCGTCACGCTGATCGCGTAGCTGGTAATACCCCAGTCGTGCTTGCACGCATCAAT